What is the appropriate Ligand?

More Galal Elmanfe's questions See All

What is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription (GAGTTCCAGGTCACTGTCACTGGCTCAGGGA) ?

GAGTTCCAGGTCACTGTCACTGGCTCAGGGA

02 August 2020 139 8 View

What is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription ?

what is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription ?

13 July 2020 7,601 3 View

Can you give an example for a clinical Decision Support System in Dentistry with its link online?

I am searching for any type of clinical Support Systems or programs in Dentistry, present online or found as a free software online.

10 September 2014 9,137 3 View

Binary Logistic Generalized Linear Mixed model in SPSS. Is it doable?

I want to analyses the proportion of swimming sperm of three species of fish in two salinities. To analyse the proportion of swimming sperm in a Generalized Linear Model, I would use a Binary...

03 March 2021 2,297 3 View

Is There Any Feasible Method To Test Fluorescent Compounds Other Than Fluorescence Spectrometers ??

Is There Any Feasible Method To Test The Efficiency Of Fluorescent Compounds Other Than UV Spectrometers ? Suggestions Would Be Appreciated !

02 March 2021 5,785 3 View

Good morning research fellows, Has anyone worked with senna alata plant extract on any kind of fish?

Literatures on the piscicidal effect of sennaa alata is scanty. if you have any related litrature either in the bark, leaves or roots used as treatment to any aquatic organism please kindly help...

28 February 2021 9,138 2 View

How to calculate Ligand-active site distance in a ligand-protein complex from MD simulation?

I have run a MD simulation of a ligand-protein complex in GROMACS using CHARMM forcefield. Reviewer has asked me to calculate Ligand-activesite distance and binding free energy of ligand with...

27 February 2021 4,703 1 View

Experimental Design: How deal with pseudreplicates with immunological and clinical-chemical paramaeters?

Hello everybody, I am investigating the influence of a toxinon various clinical-chemical and haematological parameters in fish. I have three treatments (control, low dose, high dose) in my...

24 February 2021 1,243 1 View

Hi i want to ask that in order to find out LC 50 (96 hours) of particular toxin for fish. Should we keep the animals with food or without food?

if we expose the fish after acclimatization to particular toxin in order to find out LC 50 (96 hours).Should we keep the fish off feed or with feed for that duration. Some literature show that...

24 February 2021 357 2 View

Measuring Total immunoglobulin whole-body of fish larvae?

Hi Dear All, I prepared the extract of fish larvae whole body with PBS. Then protein concentration of the whole-body extraction samples determined by the Folin-Ceiocalteu-Phenol method (Lowry...

17 February 2021 1,971 3 View

What is the identity of additional bands found during fish gut microbiome 16S V4 PCR amplification?

Hi, I am carrying out test PCRs for 16S amplicon sequencing on Illumina MiSeq. I am using standard V4 primers: 515F/806R. The aim is to profile the microbiome of fish guts under different...

16 February 2021 5,668 6 View

Can I measure absorbance efficiency with wavelength in a spectrophotometer?

I measure the wavelength of material in a spectrophotometer and it peaks at 275 and its absorbance is 100. I mix it with an adsorbent and it adsorbs the first material, but when I measure the...

16 February 2021 7,515 5 View

How long does it take to design and validate transition state analogue inhibitors?

Hi, I'm asking from the point of view of designing a research plan: How long (approximately) can it take to determine the transition state structure of an enzyme substrate using kinetic isotope...

14 February 2021 2,610 1 View

Alaa Frak Hussain

There are several specialized ligands doing this

Galal Elmanfe

thank you , can you give me some examples for these ligands please

There are ligands prepared to determinte lead and cadmium. For example? 1- 4-(2-pyridylazo)resorcinol. 2- 2-(4-methoxy phenyl)azo)-4,5-diphenyl imidazole

thank you for your answer