What is a good cutoff value for a PLGS ladder score?

12 June 2014 0 2K Report

I'm running PLGS to identify peptides from an online pepsin digest using PLGS. I usually use Sequest and I am familiar with the scoring system (Xcor values etc.) PLGS gives these ladder scores and I'm not sure what a cutoff level is for an acceptable confidence value for a peptide ID. I've see then range from 10 to over 90. Any insight or suggestions?

Badges
Science topic

Similar topics
Psychology

More Dennis Pantazatos's questions See All

How to carry out micro preparation of Zn-2 (Zamak 2) sample surfaces?

I am currently struggling to achieve a good surface finish on mounted Zn-2 samples. Both grinding and polishing (with SiC, silica and diamond) resulted in embedding of the grinding/polishing media...

11 June 2024 2,055 0 View

FFPE mouse femurs appear to have internal bubbles?

I am wondering if this is a technical issue that occured during processing. I have murine femurs that were decalcified in 15% EDTA over 2 weeks and then processed and I embedded them into FFPE....

02 April 2024 6,382 2 View

Is it necessary to include an FMO for 7-AAD dye in your Flow Cytometry experiment? If not, why?

I'm optimizing a flow cytometer experiment and one of my three stains is a 7-AAD Live/Dead stain. The other stains in my experiment are staining for CD34+ and CD45+ cells. Is it necessary to...

01 April 2024 3,060 0 View

What is best way to get lowest adsorption site at subsurface of high entropy alloys?

I am currently studying diffusion of oxygen in high entropy alloys. I want to calculate the activation energy from an adsorption site on the surface to the subsurface. I placed the oxygen atom...

26 March 2024 3,268 0 View

Examples of gender norms that affect men and women's participation in agriculture?

It is a course unit called gender and social economic issues in development ARX 1201

07 January 2024 365 0 View

Is it necessary to to conduct independent simple regressions for a multivariate regression model or this can be derived from the multiple regres?

The objective here is to determine factor sensitivities or slope coefficients in a multiple ols regression model.

17 August 2023 7,825 5 View

Does anyone had problems installing Cytoscape in Ubuntu 22.04.2 LTS?

I am trying to install Cytoscape in Ubuntu 22.04. I followed the instructions on the official website and installed Java 11, 17 and 18. None seems to work. I had this error every time: Error:...

30 May 2023 9,889 2 View

Why is it that when I open a structure and I select atoms in Vesta it crashes immediately?

I am trying to work on a structure in Vesta. But after opening, it crashes when I select atoms to delete. Any help would be deeply appreciated

07 March 2023 5,805 4 View

Working primers for human NPC1 and TrkB qPCR?

For one of our experiments we are planning to run a qPCR on cDNA from human samples. In our first test, we found that our primers for TrkB (forward: ACAGTCAGCTCAAGCCAGACAC, reverse:...

24 January 2023 4,508 3 View

Can standardize test be a data collection tools for descriptive study?

Good day scholars, I am doing a descriptive study and want to administer a standardize test, is it possible?

21 September 2022 6,517 1 View

Can you connect an HPLC to a Mass Spec only at a certain time point?

Can anyone explain this method? Especially the last statement where it says only at 1.5 to 2.5mins was the MS/MS connected to the UPLC. How is that possible, is it a feature in this specific...

11 August 2024 8,141 3 View

GC-MS retention index prediticon?

Hello experts, Does anyone know any free software about retention index prediction ?

08 August 2024 7,403 2 View

How to calculate CCS for Sodiated adduct ions and Multiply Charged Ions?

I'm currently working on calculating the collision cross section (CCS) for various ions, and I'm facing challenges when dealing with sodiated and multiply charged ions. Most of the resources I’ve...

08 August 2024 8,329 0 View

Can anyone provide me with molecular docking softwares/ websites?

Molecular docking software/ websites?

02 August 2024 8,704 7 View

Where to find a gene list for CRISPRa/i library screening of regulatory factors that affect pathogenic Th17 differentiation in PBMC?

I want to perform a CRISPRa/i library screening for candidate regulatory factors that affect pathogenic Th17 differentiation in PBMC. But I am wondering how to define the size of gene library, so...

31 July 2024 2,150 0 View

Hello dear researchers. I would like to know what is a normalized mass in an EDX analysis?

EDX analisys

31 July 2024 5,947 2 View

Gas chromatography RT detection?

I am working on algal extract to which gas chromatography (Not GC-MS) spectrum I want to discover. My question is can we identify specific compounds using retention time if I compared the RT with...

29 July 2024 8,034 4 View

CAD File of human's & rat's respiratory airways ?

Dear all, I am working on particle deposition in human's & rat's respiratory airways using CFD and I am looking for the 3D CAD file for my simulations (STEP or IGES format). If somone has such...

29 July 2024 1,092 2 View

I am working on my Master's thesis on the biogeography of the genus Ruagea and I would like to ask, could someone help me to check whether my result?

I created a file with my outgroup and ingroup species using Beauti, ran it in BEAST, viewed it in Tracer, and then used TreeAnnotator to create a file that I imported into RASP. Could someone...

28 July 2024 2,979 1 View

MAGeCK Plotting Error: Logarithmic Axis Must Have Positive Limits?

I have been running a MAGeCK test command on the terminal for a CRISPR screen to rank sgRNAs and genes based on the read count tables. However, I get only the plot of the top-ranked genes...

28 July 2024 9,811 1 View