Dear Sir/Madam,
I am looking for a deletion or insertion anomaly in the CALR gene. After sequencing the same sample (Forward/Reverse), here's what I get. From the chromatograms we deduced that there was a deletion, but we can't identify exactly which nucleotide(s) it is.
I'll leave you with a picture of the results and if you have any answers or suggestions, please contact us.
Sincerely
PS: (ref seq) GCAGCAGAGAAACAAATGAAGGACAAACAGGACGAGGAGCAGAGGCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGGACAAGGAGGATGATGAGGACAAAGATGAGGATGAGGAGGATGAGGAGGACAAGGAGGAAGATGAGGAGGAAGATGTCCCCGGCCAGGCCAAGGACGAGCTGTAG
The best option to figure out which nucleotides are deleted is to clone and sequence the PCR product. E.g. clone it into a TOPO TA Cloning Kit (unless you used a proof reading Taq then you need to use a Blunt-End Cloning Kit). Do single colony PCRs with vector-specific primers, clean the PCR products and send some of them (4-6) for Sanger sequencing.
Why don't you align the sequence as Lo Tzu Yu suggested? When you receive your sequencing results you usually get a file which contains the results in the form of nucleotides. You can align this with your reference sequence and see where the nucleotides are missing in your sequenced sample.
I like to use a website called Multalin. You simply type your sequencing result and then your reference sequence, hit Submit and look at your alignment.
Message me if you need help with this :)!
Thank you for your answers. Unfortunately, our laboratory doesn't have the resources for cloning. As far as alignment is concerned, I obviously did it (as show down below), but since we're talking about heterozygous mutations, the normal allele dominates and gives a normal FASTA sequence, but when we look at the peaks we can clearly see that there's another allele, in which it's hard to read the mutation clearly.
- Badges
- Science topic
- Similar topics
- Analytical Chemistry
- Column