I am trying to insert my PCR amplified product into pET26b-SET vector. I am using BamHI-HF and Xhol double digestion to remove the SET from the vector and introduce my insert. I used the suitable buffer suggested by NEB double digest finder tool. The agarose gel separation of the digested vector mix shows that SET has been removed from the vector backbone. I tried doing the transformation twice, once using NEB 5alpha competent cells and the other time using NEB 10beta. But I could not get a single transformed colony. Which step should I optimize?
Hi,
Which buffer was suggested by NEB? And have you purified your digested plasmid backbone from the agarose gel?
Digesting your PCR product is probably more critical. Unfortunately, you cannot see the success in a gel. Are there some additional bases between the end of the molecule and the restriction site? This is very helpful and sometimes even essential for restriction enzymes.
Additionally, you could use another plasmid as control for your transformation. Are you sure that your competent cells are working? Moreover, this control will show if your selection media is suitable.
Good luck with your cloning!
To understand the details, could you please upload the primer sequences?
Hi there,
There are three critical steps for cloning : digestion, ligation and transformation.
Obviously the vector digest is OK as digest is generating two bands on gel. Do you gel purify the vector? About the insert, as mentioned above, it is a bit more tricky to check efficient digestion. To improve it, I systematically add three extra bases at each extremity of the PCR product and gel purified the digested PCR product.
About ligation, the essential issues are a limited amount of vector (not more than 100ng per 20µL ligation reaction), molar ratio between 3:1 to 5:1 (insert:vector) and run the controls (vector alone without ligase to evaluate the non digested vector and the vector alone+ligase to evaluate the self ligation event) and don't hesitate to incubate ligation for a long time in a cold room instead of incubation at room temperature for a very limited length of time. A further ligation control would be to run self ligation with a single digest linearized plasmid to check actual ligase activity.
Finally transformation : run a control with 0.1ng of circular plasmid (usually pUC derivative) to check transformation efficiency of the strain (normally you should get at least 100 transformants from this control corresponding to 106 cfu/µg of DNA which is the threshold for competency for cloning purpose). And don't hesitate to plate the full transformation mix on several plates. Plate the same volume for controls and your ligation to compare results.
NEB suggested to use Cutsmart in which both of the enzymes have 100% activity. I purified the plasmid backbone from gel. Just before the restriction site, I have 4 nucleotides in my primer. I think my competent cells should be efficient because I had used the same cells to clone the same insert into a different vector. I used 44ng of vector and I maintained 3:1 insert:vector ratio.
I run the control (vector alone +ligase ) and I saw a band around 2 kDa. I feel like there is a faint band around 6/7 kDa. Vector backbone is of 5.3 kDa. Does this suggest that the vector is self ligating?
Hi again,
To get a better view, you should compare vector-ligase with vector+ligase (any difference in these profile will tell you that something has actually happened), in parallel just run the transformations.
Yea I have 4 nucleotides at the end of primers. My primer is
Forward: 5'AGCTGGATCCATGGCGGCGGCCGACGGCGACGAC 3’
Reverse: 5'AGCTCTCGAGGGCGAGAGACAGAACAGTCAGAGCC 3'
I had run several combinations:
1. undigested vector only (2 bands observed one at 5.3kDa and other at 7 kDa
2. digested vector only ( band ~5.3 kDa is observed which is the right size for vector backbone)
3. digested vector+lligase ( band ~2kDa)
4. digested vector+ligase buffer (band ~5.3 kDa size )
Hi again,
There could be something wrong with your primers. Mistakes during synthesis are rare, but they can happen. One mutation in the restriction site would prevent the enzyme from cutting it.
However, have you thought about an alternative cloning strategy? You could generate the same final sequence via Gibson assembly. Ordering new primers could be cheaper than repeating digest, ligation and transformation several times. Additionally, this could save you some time.
Best,
Boas
Hi Babita, when you face lot of problems with the regular ligation protocols (meaning restriction endonuclease-dependent ones) I would strongly recomend to try ligase independent cloning (LIC). If you can afford commercal kits there are some that work very well like the NEBbuilder assembly mastermix from NEB or otherwise try any protocol using T4 polimerase. In both cases you will have to re design your primers but these approaches have efficiencies above 90%. Check the following links for general information and the last one is the kit I have been using.
https://www.neb.com/applications/cloning-and-synthetic-biology/ligation-independent-cloning
https://www.addgene.org/plasmid-protocols/lic/
https://www.embl.de/pepcore/pepcore_services/cloning/cloning_methods/lic/
https://www.neb.com/products/e5520-nebuilder-hifi-dna-assembly-cloning-kit
Good luck
Dear Babita, many things have already been said. Just one thing: when u digest your vector to remove SET you should see the insert in addition to the backbone on the gel, did that happen? Because you wrote you just had one band?
And as suggested before, just make a test, in which you transform your cells with the exact vector (0.1 ng or so like suggested before) that you also will use for the final construct. This will tell you is this vector works in these cells with the antibiotics concentration you choose etc. No colony at all to me suggests something there could be the problem.
Greetings
Daniela
- Badges
- Science method