What are the general procedures for estimating binding capacity of a specific radiopharmaceutical with human protein in vitro?

26 November 2013 1 9K Report

We estimated the binding of one radiopharmaceutical on human albumine in vitro some years ago. If I remember well we incubated the RP preparation with HSA solution at 37°C and estimated the binding capacity after GPC separation radiometrically.

Badges
Science topic

More Nadeem Ahmed Lodhi's questions See All

How can I find the cracked version of ENVI-met software?

Envi-met software

07 August 2024 8,188 1 View

Entropy measure and QSPR modeling in Graph Theor. How to construct the table for lengthy equation?

The entropy measured of molecular graphs plays a crucial rule. The network structures in some cases are very lengthy calculations to handle. Some author avoid to construct table where as most...

30 July 2024 3,126 0 View

Critique Calculaltion in Topological Indices and QSPR Modeling?

The first step is to analyze a 2D molecular graph and implement partitioning techniques to calculate the topological indices. Secondly impose statically tools to generate QSPR model, may or may...

24 July 2024 9,644 1 View

What strategy should be adopted to calculate topological indices efficiently?

Most of the time it is observed that in many manuscripts there are several typo error of topological calculation errors of calculation and partition of edges what ever the type of partitioning it...

22 July 2024 811 0 View

Nicotiana benthamiana seeds sterilization methods for tissue culturing?

I have been trying to grow Nicotiana benthamiana via tissue culture. I used ethanol and sodium hypochlorite with different concentrations and time duration for seeds sterilization and lastly...

18 June 2024 1,756 3 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

How to address the challenges associated with sustainable agriculture and water resource conservation in mountains ?

Looking for a research and development solution for restoring agriculture and water sources particularly natural springs in Indian Himalayan Region.

20 May 2024 9,717 3 View

QSPR model is not fit for or it does not deliberate best answers. How we can improve it?

The QSPR analysis some time fails to produce relevant answer. what we should do to get improve results.

29 August 2023 7,764 2 View

What the difference exists between the QSPR analysis by using 2D and 3D model of drugs structures?

Where as some authors use 2d model and other use 3d model. How we can distinguish what the difference. Are the results same or different?

27 August 2023 552 2 View

What precautions should be taken while handling S. aureus enterotoxin Type B in the lab?

I would like to understand potential safety concerns while handling SEB in the lab. Especially while working in animal house facility. Would like to know precautions for handling. Sigma MSDS...

07 August 2024 6,034 3 View

Why does my protein refolded to beta sheet during thermal denaturation analysis?

Hi! So i attempted to understand a novel protein behavior towards heat application by analyzing its secondary structure change. I subjected the protein to a thermal denaturation analysis using...

06 August 2024 1,989 3 View

How to understand this crystallographic phenomenon of low temperature crystals in zeolite?

During low-temperature testing, new diffraction peaks that appear could be indicative of several phenomena. In one of our tests, we observed notable new peaks around 40° and 45° in a specific...

06 August 2024 726 3 View

Weak DAPI staining after immunohistochemistry - how to improve?

After immunohistochemistry of previously fixed in PFA and EtOH and then frozen 20 μm sections of zebrafish brain, DAPI staining is very weak (right) compared to the same sections stained without...

05 August 2024 9,637 2 View

How to isolate lymphocytes from mouse spleen?

I have tried several times to isolate lymphocytes from mouse spleen, but all attempts have been unsuccessful. I tried most available protocols. I used different dissociation media (HBSS with Ca...

04 August 2024 9,913 7 View

Transfection in HEK293T cells?

Dear All, I am trying to transfect a pCDNA3.1 vector containing my gene of interest. The purpose is to figure out the localization of the protein of interest. I have fused the protein with GFP on...

31 July 2024 9,892 4 View

Is artifacts in XPS possible to build high deviation in binding energy larger than 5 eV??

Hello. Thanks for your consideration to see my question. Recently, I conducted XPS anaylsis of g-CN that is prepared from thermal polycondensation of DCDA, so-called conventional bulk-g-CN,...

30 July 2024 9,824 2 View

How to retain the a GFP tagged gene expression in stable cell line?

Hello , I established a stable cell line expressing GFP tagged to a centrosomal gene having G418 drug selection marker. I validated the stable line by IFA and Western blotting, results are fine....

29 July 2024 5,007 0 View

Do some Staphylococcus aureus strains have in vitro antimycobacterial activity ?

Some Staphylococcus aureus strains Inhibit the growth of Mycobacteria in Mueller Hinton Agar medium containing 10% OADC. Do some Staphylococcus aureus strains have in vitro antimycobacterial activity?

29 July 2024 10,023 2 View

What is the relationship between protein structure and N or C terminal tagging choosing?

I want to do 2,3-butanediol dehydrogenase(BDH) enzyme purification to confirm its activity for 2,3-butanediol. Before that, I need to confirm which N or C terminal tagging is better for enzyme...

28 July 2024 366 3 View