I am exploring a number of SNPs, unfortunately although the test are ok, I am perplexed because my preliminary results are nearly all against what is reported in the literature.
To confirm my workings, I need to understand if I have done this correctly.
I am using prepared primers from TaqMan for a realtime PCR. This uses two dyes: VIC and FAM, each associated to one allele.
An example of a primer would be the following:
CCAGCGGATGGTGGATTTCGCTGGC[A/G]TGAAGGACAAGGTGTGCATGCCTGA
where the manaul stated that A should be VIC and G would be FAM.
Does this mean that those results with a low Ct on VIC and a high Ct on FAM would be A or G allele?
As long as you're certain VIC is for the A allele, and FAM is the G allele then a low CT on VIC will be an A.
https://bitesizebio.com/24581/what-is-a-ct-value/
If you are seeing amplification and detection of both alleles, then both alleles are present. The question is if this is due to contamination or if it's real data.
What is the lower limit cutoff of detection for your probes?
Is the signal higher than the "noise" in your negative control?
Are you samples from single individuals or from a pool?
Finally, are you certain that A is labelled with VIC and G with FAM? If you didn't order them yourself, ask to see the stock tubes.
- Badges
- Science method