Hi everyone,
If two primers have melting temperature of (forward ) 69.33°C and (reverse) 64.03°C, what would be the annealing temperature ?? Help me in finding the PCR protocol. Kindly reply
@ Arul N....Don't worry about the difference and high annealing temperature(Tm) in forward and reverse primers follow the following steps...
1. Take the mean of both the forward and reverse primers Tm .
2. Go for gradient PCR in the range of + and - of 5 C of the mean Tm you have taken.
sure you will get the amplification... if you have standardized protocol for remaining things in the PCR....
good luck.....
Hi Arul
here the primers melting temps are too high.they must be below 60 and it is better to both the primers should have almost equal melting temperatures..
Usually aling temperature with the temperature of primer lower (64.03 ºC), but is necessary do a standard curve. Do you use to 57°C from 69 °C on standard curve, thus you find the better temperature.
@ Arul N....Don't worry about the difference and high annealing temperature(Tm) in forward and reverse primers follow the following steps...
1. Take the mean of both the forward and reverse primers Tm .
2. Go for gradient PCR in the range of + and - of 5 C of the mean Tm you have taken.
sure you will get the amplification... if you have standardized protocol for remaining things in the PCR....
good luck.....
Hi Arul,
Greetings!
I agreed with the comments above. When designing primers itself, we should design in such a way that the melting temperature of the forward and reverse primers are close enough. This is because the annealing temperature is dependent on this basically. this melting temperature will give us the idea on the range of annealing temperatures to be used to test the primers.
However, since you have already obtained the primers, follow as what Mr. Anand Khot said. Do a gradient PCR. This will give you a range of PCR products in terms of intensity at each annealing temperatures selected and by which you should be able to pick the best optimum annealing temperature. Once you get the rough range you can perform another gradient PCR in order to narrow down your annealing temperatures. Once you get the annealing temperature, you can also play around with the primers concentration, by trying with different combinations of forward and reverse primers concentration because sometimes the forward and reverse primers are need in different amount to give an optimum result.
All the best!!
Hi
Thank you for all your suggestions and information. The master mix that I'm using is from ready made KIT, which does not have DMSO. I think DMSO will reduce the annealing temperature. Unknowingly I took the primers with different temperature. The only hope is to follow the steps of Anand. Thank you A.Khot. I believe that I will get amplification.
What do you mean about standardized protocol for other things in PCR?
Kindly reply:-)
@ Arul.N..
Standardized protocol means I was talking about ...
1.The Template(DNA) you are going to use in PCR about its quality and quantity....
2. The PCR components means Buffer,MgCl2,dNTP's and water......
Since you are using the master mix the second point is ruled out here....
Now the only concern here is about Your Template(DNA)...
1.To rule out this use 2-3 different templates of your choice....
Mean while let me know from which samples you are going to isolate DNA and the protocol you are following...
good luck...
Hi Anand
I already isolated DNA with Proteinase K and RNase. It's human genomic DNA from whole blood. The quality is also good when checked in UV- Spec. The region that I'm trying to amplify is the ribosomal Intergenic Spacer region. The primers are
5' ATTCGGAAGCTTGACAGGCGCAG 3’ 20296 ---> 20318 (Forward)
5' GAAACCCCCTGACTCAGGTCAAG 3’ 21032
@Arul N...
It's good to hear that you got good quality DNA a faint band at least....
1. For your gradient, try in the range of + or - (63 C) means 58 C to 68 C as 1st gradient....
2. For your respective desire band size (bp).....check the sizes of the gene you are trying to amplify...
3. Let me know the concentration and OD at 260/260 of the DNA you have checked and the result for your next PCR...
4.Meanwhile forward your gel photo let me see and suggest you further....
good luck...
hi
I didn't get any band even in gradient PCR with annealing temperature range of 57°C- 66°C. Can a primer seen as a slender band or is it amplification? Sorry, I don't have the gel picture. And the thing is, the region to amplify is not a gene, it's non- transcribed spacer region or Intergenic Spacer(Accession No: U13369). I need to know the product size.
The OD values are between 1.5 to 1.7(A260/A280)
Kindly reply
@Arul N...
1. Did you put ladder along with your gel....the slender band you are talking let me know it's size..
2. Better you provide me gel photo it will be better to explain the things...
3. The OD of DNA is in between 1.5 -1.7 means there is contamination (may be protein) with DNA I think I pointed out this in my second comment.... .let me know the concn also...
4.Give me the details of your PCR programme....
Don't be discourage it's part of research it will happen try one more gradient by diluting your DNA...
good luck....
- Badges
- Science method