Hi, everyone, I want to insert one heterogeneous protein gene into the chromosome of one bacterial strain, How can I choose the locus in the chromosome for insert heterogeneous gene to let that heterogeneous gene expression? Secondly, Is there any good method to enhance the one heterogeneous protein in the chromosome of a bacterial strain?
Secondly, Is there any good method to enhance the one heterogeneous protein in the chromosome of a bacterial strain? or is there any relevant literature?
Any comment is appreciated!
Hi Bingming. you can do this with the system developed by Datsenko & Wanner (Proc Natl Acad Sci U S A 2000;97(12):6640–5) which was originally designed to make knockout strains in E.coli but can be easily adapted for replacing genes or including genes at specific genome sites using the desired promotors for higher expression levels. You will need the plasmids PKD46, PKD4 (or PKD3), and pCP20 for performing the gene integration. Good luck!
@Josef Voglmeir Thanks to Dr. Voglmeir's valuable suggestion, I appreciate, Could you tell us how to choose the promotor, what kind of promotor is good for express heterogeneous protein in the chromosome of E. coli? and how to design the layout the position of the promotor and the gene I want to express? Best wish!
Hi Bingming, we normally use this sequence as constitutive promotor (we just took it from a pet system):
tttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgaacaataaaactgtctgctta
cataaacagtaatacaaggggtgtt***
I am quite sure that you dont need the whole whole sequence, but we did not try to shorten it - you can add the start codon of your gene of interest where you can see the three asterisks.
Good luck!
- Badges
- Science topic
- Similar topics
- Biological Science
- Microbiology
- Microorganisms
- Bacteria