My PhD student has been working with eDNA samples working on 2 genes namely COI (Leray's-313bp) and the MiFish-12S primers. He is using Illumina overhanging adapter with specific primers to amplify each samples, which means the primers became quite long with additional 30+ bp of the overhanging adapter (for each ends). He is now having problem with COI amplification. He did try a lot of protocols including Leray's touchdown PCR method, from using normal taq polymerase to using HiFi proofreading polymerase. And finally when he used HiFi polymerase there are some clear bands of non-specific amplification at 100bp+ region. However, we suspect that the bands are not the target size. With the COI primer, he is supposed to get 313bp, and with the addition of the overhanging adapters (+67bp), he is supposed to get a product with 380bp. But the product size is at 450bp+.

We need some advice here, because he is using pre-stained GelRed, and it may cause some issues with slow DNA migration in gels. Or probably, he did not amplified the right mtDNA. His positive control, labelled FISH did amplify at 400bp-ish. He repeated with the gel, but he still get similar band patterns. Is it possible that the target size is higher with the primer his using? He also gets a faint band on the negative control. He is sure that all his chemicals are fresh and he used fresh nuclease free water in the experiment.

The details of primers used-

mlCOIintF: 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGWACWGGWTGAACWGTWTAYCCYCC

jgHCO2198: 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTAIACYTCIGGRTGICCRAARAAYCA

*the underlined nucleotides is the Illumina adapter

from: Leray, Matthieu, et al. "A new versatile primer set targeting a short fragment of the mitochondrial COI region for metabarcoding metazoan diversity: application for characterizing coral reef fish gut contents." Frontiers in zoology 10 (2013): 34.

Is it possible that the HiFi polymerase caused this 'contamination' to occur, because he did not see any bands or smearing for the negative control when he used the normal taq KAPA HiFi HotStart ReadyMix (2X) and buffer.

Can someone help us. We are at our wits end trying to figure out these problems. Thank you.

More Noor Adelyna Mohammed Akib's questions See All
Similar questions and discussions