Hi,

Not a good curve is due to not good amplification efficiency.

You need to serially dilute your cDNA , atleast a 5 point dilution with 1:10 ratio as the initial conc. Say your initial conc is X. You dilute that 10 times and take 2ul from that and dilute again 10 times atleast for 5-6 points. use each cDNA diluted sample and do an RT in a control sample with whatever primers you have.

You shpuld get a good range of Ct ranging from 15-30 . Donot go beyond 30and below 15. Also the Ct will vary according to your gene.

Good luck

you can try on to make the standard curve using: dilution of your PCR product or cloning of your PCR product. Blessings

Hi,

Not a good curve is due to not good amplification efficiency.

You need to serially dilute your cDNA , atleast a 5 point dilution with 1:10 ratio as the initial conc. Say your initial conc is X. You dilute that 10 times and take 2ul from that and dilute again 10 times atleast for 5-6 points. use each cDNA diluted sample and do an RT in a control sample with whatever primers you have.

You shpuld get a good range of Ct ranging from 15-30 . Donot go beyond 30and below 15. Also the Ct will vary according to your gene.

Good luck

Hi, Mohamed, I suggest you to look carefully on this paper: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1274258/

You should also check your cDNA and primers quality.

You can ask some good workning promer form the other lab membres to be sure about it quality.

And, as Kalpita sugegst, make a serial dilution of your cDNA.

If despite all the suggestions, it still does not work, then you should consider changing the primers, and testing different sets in order to find efficient ones, Best luck

I had the same problem, but the simple reason I foud, pipetting your samples it is very important to get accurate volume and accurate conc. just try this and you will get a good standard curve. Good Luck

Hi Mohamed

check out this one ! I think you need to calibrate your curve.

http://terpconnect.umd.edu/~toh/models/CalibrationCurve.html

Hi,

A five fold dilution curve usually works for me. Can you tell us the slopes that you are getting?. As Olga suggest, if nothing of the above works, go for new primers.

Good luck!

Hi,

are you sure that your gene of interest is (highly) expressed in your sample used for the standard curve? Have you checked the cDNA quality by housekeeping gene amplification? Maybe you should use the (cloned) PCR product as standard.

Good luck!

Hi what do you mean with your points are two far for the slope. does it mean that you have some points (obtained from a serial dilution) that do not follow a line with good slope?? if so the best its try what most people suggest use a PCR template or cloned fragment as template in your standar curve with either 1/2, 1/5 or 1/10 dilutions. If it does not work you should change the primers they do not work.

Mohammed,

Be sure check melting/dissociation curve. Make sure you have one pick with your primer set. Check also end point bands. make sure you have one fragment.

These two primer sets give me good melting curve and calibration curve:

cDNA GAPDH

GAPDHcDNA-F601 agcctcaagatcatcagcaatg

GAPDHcDNA-R677 aagttgtcatggatgaccttgg

DNA B-globin

Bglob-F48 ACC-ATG-GTG-CAT-CTG-ACT-CC

Bglob-R205 CTG-TCT-CCA-CAT-GCC-CAG-T

Good luck.

Hello,

I use serial 10-fold dilutions from 10^10 copies per ul down to 10 copies/ul of cloned PCR product. The slope should be roughly -3.323 this way (2^3.323 is about 10). If you are using an appropriate amount of cDNA all genes should lie on this line (even 18s rRNA). Do your primer sets amplify 1 target when you optimize for annealing temperature and examine on agarose gels? What do your melt curves look like? What is the size of your amplicon? Are you allowing enough time for your primer extension to run? Even something as simple as when you are reading your signal can be affecting your values.

Good luck.

Jason

is there any journals on adult bovine serum production

If you are using a cDNA to make your standard, make sure your gene expression is very high. First thing to do is, run a qpcr test for your target gene (or house keeping gene) using a sample (positive control. from cells, tissue...) which is know to have a high expression of your interest gene. If you don't have a good qpcr results, you need to check your primers , your RNA (quality...) or your Reverse thranscription.

Hope that will help

How about your positive control curve? is it OK?

if not perhaps the PCR set-up not good.

if good, it would suggest you run on agarose first to check is there any amplicons produce as troubleshooting step. If there is, then it might be your primer got no fluorescent.

Do a melt curve at the end of your qpcr. Do you get low melt products with melt temp between 70 to 80 c in addition to your gene specific product in the 90s? Of so this indicates primer dimers. In this case reduce your primer concentration.

I feel technical problem here. As all have already suggested, try to use the cloned PCR product or check the quality of cDNA with reference control. Make serial dilutions as Kalpita suggested and If you, still find the same problem then just change the primers.