The PCR method had 99% inclusivity and detected 2 copies of Salmonella species DNA per reaction. Primers specific for Salmonella-separate fragment 1in conjunction with the group D set had 99% inclusivity for 32 S. Enteritidis isolates Salmonella .

Thanks, but what's the reference?

Victor Marin https://scholar.google.se/scholar?q=salmonella+specific+primers&hl=en&as_sdt=0&as_vis=1&oi=scholart

Rafi Ullah

You yourself do not understand things in molecular biology and microbiology, asking nonsense question and now copy-pasting nonsense things. Stop spamming.

Abhijeet Singh, out of these 430,000 results, what is the best pair of primers?

Please try to put some effort in reading some research article and get some understanding about the primer pair and then decide on your own what you think suits you.

Unfortunately, some researchers answer the questions just to increase the RG Score.

Maybe. And some of the people want to get spoon fed with the already chewed food.

OK.

I have the primers described below in the lab. What do you think? Is there a better pair of primers?

GGACTTTTTAAAAGCGGCGG

GCCTCTCCCAGAGCCGTCTGG

Hi Victor, primers targeting the invA gene of Salmonella have long been used to detect a wide variety of Salmonella serovars. Rahn et al. (1992) is often cited for the development and validation of this set of primers. [Article Amplification of an inv-A sequence of Salmonella Typhimurium...

Here is the set of primers from Rahn et al. (1992):

5´- GTGAAATTATCGCCACGTTCGGGCAA

5´- TCATCGCACCGTCAAAGGAACC

This set of primers should produce a 284-bp DNA fragment.

Alan, thank tou.