Dear Bianca Zarrella,

I suggest to you links and attached files in subject.

-Guidelines for PCR Optimization with Taq DNA Polymerase | NEB

https://www.neb.com/.../guidelines-for-pcr-optimization-with-taq-...

-Taq DNA Polymerase Guidelines for PCR Optimization | NEB

https://www.neb.com/.../taq-dna-polymerase-guidelines-for-pcr-op...

-PCR Troubleshooting | Applications & Technologies | Bio-Rad

www.bio-rad.com/en-us/applications.../pcr-troubleshooting

-Guidelines for Optimizing PCR: Concentration of Target DNA and ...

https://agctsequencing.wordpress.com/.../guidelines-for-optimizing...

Best regards

Hi Bianca! Typically 0.1-0.2 nmol are a good range for primers in a 50 uL reaction.

The weight of your primers in ng depends on their composition, as different nucleosides have different molecular weights, and you can calculate the molecular weight of your specific primer using the following formula:

Primer Molecular Weight = (An x 313.21) + (Tn x 304.2) + (Cn x 289.18) + (Gn x 329.21) - 61.96

I give you some examples here:

-the relatively short primer ATGCATCGATCGATC has a molecular weight of 4552 g/mol (or ng/nmol).

-the relatively long primer ATGCATCGATCGATCATGCATCGATCGATCATGCATCGATCG  has a molecular weight of 12873 ng/nmol.

I presume that your primers will have their molecular weights somewhere between the two examples shown here, which means you should add your primers in the range between 450 - 2500 ng of each primer to your 50 uL reaction mixture (which already considers the range of 0.1-0.2 nmol variation).

You can further narrow down this estimation if you know the sequence of your primers. Good luck!

Use 500 nanomolar primers or as recommended in the supplied manual of the polymerase you are using, from a 100 micromolar stock of the primers. 

Make 100 micromolar stock of the lyophilized primers 

nmol of primer X 10 = volume of TE required for 100 micromolar stock