Hi Everyone,

I am working on amplifying two fragments of LINE-1 elements, a short fragment (97 bp) and a long fragment (266 bp), using SYBR Green-based qPCR. The template is cell-free DNA (cfDNA) extracted from the plasma of breast cancer patients.

For assay validation, I first generated a standard curve using synthetic DNA after optimizing the annealing temperature to 57°C. The PCR efficiency for the 266 bp LINE-1 fragment was 1.748 (i.e., ~74.8%) with an error of 0.0573, which is suboptimal.

However, when I applied the assay to patient samples, I observed significant variation in the 1 ng standard across plates, leading to inconsistent and unreliable data.

The primer sequences used for the 266 bp fragment are:

• Forward: ACTTGGAACCAACCCAAATG
• Reverse: CACCACAGTCCCCAGAGTG

I would appreciate any insights on the following:

• What could be causing the large variation in the standard (especially for the long fragment)?
• Is the low efficiency due to primer issues, amplicon size, or cfDNA fragmentation?
• Any suggestions for optimizing this assay for reliable cfDNA integrity analysis?

Thanks in advance for your valuable suggestions!