Is there anybody provide me the real time PCR primers for firefly lucifease ?

More Mohammed Arif's questions See All

What is the best method available now to perform comparative proteomics in human serum samples?

Hi Everyone Our group wants to compare protein expression levels in human serum samples. So we want to do some proteomics to get the list of differentially expressed proteins in those samples....

01 February 2019 2,718 4 View

In PRIMER, is it possible to downweight certain taxa in multivariate community datasets to reflect uncertainty around identification??

I have a dataset with about 80 different species. As usual, some species are very easy to identify with certainty whereas others are more difficult, which means that I am less certain of my...

03 March 2021 8,066 4 View

How do I increase the yield of my PCR product?

Hello, We would like to increase the yield of our PCR product. We are running a series of PCR reactions that is targeting ~1.1kb sequence. We begin each reaction with ~400pg of template DNA...

02 March 2021 4,029 3 View

Research on Supply Chain Management in Indian context?

Hi, I am planning to apply for the PhD degree in the Supply Chain Mgt. with specific area of "Cold Storage warehouses" during Pandemics and wars. Where lock downs and shut downs are frequent....

02 March 2021 285 2 View

PACYC PCR not working after several attempts. Would anyone have any suggestions?

So, I have been trying to run a pACYC PCR which will be used later on for a Gibson Assembly. However the PCR is not working. I have already tried gradient PCR and changing extension time; however...

02 March 2021 1,146 2 View

Does anyone know HRM channel in a 2 plex QIAGEN Rotor- Gene Q qPCR can be used as a separate channel?

I am going to have 3 different probes in my qPCR work that I am going to do. But I realized that the machine we have in the lab is a Rotor-Gene Q 2plex HRM Platform, saying it has green, yellow,...

01 March 2021 8,544 1 View

How to calculate the annealing temperature of a primer pair?

I have to amplify a gene and my primers just reached. The Tm for Forward primer is 64.2, and that of reverse primer is 65.5. Can some one suggest how to get the best annealing temperature? Thanks...

01 March 2021 360 7 View

How to address this issue in the analysis of Real-Time PCR results?

To dear Researchers, I was analyzing a series of concentration for estimation of Real-Time PCR efficiency. The concentration was 1:10. I used MS-excel to evaluate Slope. The result of slope was -8...

01 March 2021 8,683 4 View

No title

Does anyone have the experience of using Taq Man probes in the QIAGEN Rotar- Gene qPCR machine?

01 March 2021 5,311 1 View

Anybody with an idea on how do design specific primers for detecting tomato resistance genes tm-1, TM-2 and Tm2^2?

I am trying to identify these 3 genes among some tomato cultivar collections and after aligning some sequences from NCBI, I couldn't find unique sequences to target for specific primers. There...

28 February 2021 606 3 View

What is the ideal efficiency for a qPCR?

hello everyone, I need to do standard curves for my qPCR, what is the ideal efficiency range? I tried a primer (Mglu2 receptor) that gave an efficiency of 90.2%. Is it accepted?

28 February 2021 1,254 3 View

Seán Mac Fhearraigh

Hi Mohammed,

I dont have any primers, but this assay here might be of interest:

https://www.assaygenie.com/product/dual-luciferase-reporter-assay-kit/

Seán

Christoph Neumayr

I use for firefly luciferase these primers:

qPCR-FlucFw gtggtgtgcagcgagaatag

qPCR-FlucRv cgctcgttgtagatgtcgttag

This works unfortunately not in this case but for other genes you can always check here: https://primerdepot.nci.nih.gov

Mohammed Arif

Thanks ! Seán Mac Fhearraigh

I did dual luciferase assay but it is giving me a huge variations in results with different trials.

So I want to check it via real time PCR which i hope should give consistent and reproducible results.