Hi Mohammed,

I dont have any primers, but this assay here might be of interest:

https://www.assaygenie.com/product/dual-luciferase-reporter-assay-kit/

Seán

I use for firefly luciferase these primers:

qPCR-FlucFw gtggtgtgcagcgagaatag

qPCR-FlucRv cgctcgttgtagatgtcgttag

This works unfortunately not in this case but for other genes you can always check here: https://primerdepot.nci.nih.gov

Thanks ! Seán Mac Fhearraigh

I did dual luciferase assay but it is giving me a huge variations in results with different trials.

So I want to check it via real time PCR which i hope should give consistent and reproducible results.