Gravity and rotation are perpendicular to each other.
can any budy explain how i calculate the DNA concentration for the 50ul reaction?
22 May 2024 9,557 1 View
If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...
22 May 2024 7,777 1 View
want to visualize SwissDoc protein-ligand docking results in ChimeraX.
22 July 2023 7,186 0 View
I have latest Chimera X version and I want to make an animation without using command line method. first I do not see animation tab under utilities tab. Why? second I am unable to save or encode...
29 June 2023 7,034 0 View
I am using CHI 660 E workstation. Here is the need to put my cathodic and anodic current values for galvanostatic charging and discharging. From where I can get these values? And how do put these...
14 February 2023 9,593 0 View
I tried to calculate the energy barrier for different paths of Mg diffusion on the T Graphene nanosheet using DMol3. Here I added a picture in which I tried to diffuse a Mg atom from the tetragon...
07 October 2022 4,693 1 View
Im using dMol3. But i faced this problem too many times that the calculation failed after a long period. How to overcome this?
18 September 2022 5,902 9 View
In Material Studio, i run a calculation for geometry optimization using dMol3. After 26 hours and 30 minutes it failes..... it show "'Error: Overlap matrix is not positive definite. This most...
16 September 2022 4,986 9 View
Hi, I have used central compoiste design with four variables and 3 levels which gives me 31 experiements. After performing the expeirments, I found that the model is not significant. However,...
14 August 2022 2,081 6 View
Hey there, I am using CST Microwave Studios for Power Source (Magnetron) analysis. I need help in Particle in Cell simulations to analyze the E field (V/m) value at specified distances (0.5-2 Kms)...
10 April 2022 1,272 4 View
I tried four trials of the same Copper Phosphides sample in Alkaline medium ( 0.5M KOH) with Hg/HgO reference electrode and Pt as counter electrode. I used 0.001 V/s scan rate for first three...
10 August 2024 3,629 1 View
Consider the case of negligible gravity but there is an accelerating reference frame. Its origin traces out a trajectory, or world line, seen in some inertial reference frame. The Lorentz metric...
24 July 2024 1,608 15 View
In cases where the rotational of the magnetic field H is zero, we can define this field as the gradient of a scalar function defined as the magnetic scalar potential (similar to the electric...
21 July 2024 9,633 4 View
Let's say I rotate a hexagonal crystal using Euler angles (φ1, φ2, φ3); and rotate another similar crystal using Euler angles (ψ1, ψ2, ψ3). What would be the angular difference between the final...
17 July 2024 5,582 1 View
A universe model compatible with VSLT The research of Halton Arp and Eric Lerner supports a stationary universe, and the intrinsic nature of redshift, i.e. not linked to its presumed expansion...
14 July 2024 4,092 5 View
How can anyone develop a theoretical framework that successfully unifies general relativity and quantum mechanics? how this new theory should accurately describe gravitational interactions at...
10 July 2024 5,040 8 View
Is any specific sample preparation required to perform VSM measurement of NdFeB alloy powder to get a square-shaped M-H loop? Or is it mandatory to make magnetically aligned and sintered pellets...
09 July 2024 1,969 0 View
Newton found the law of gravity - but did not understand it. Fatio understood the law - but he was not accepted. Fatio assumed fast particles moving in all directions. Stability in planetary...
30 June 2024 9,284 28 View
Hi Everyone, I plan to deposit a catalyst (TS-1@Co-PDA, in the core: TS-1 zeolite with a shell of Polydopamine designed with Cobalt) on a rotating ring-disk electrode (RRDE) to evaluate the...
29 June 2024 8,203 3 View
hi im performing IDA for a 30 story consisting of bearing wall system of special shear walls for gravity and lateral resisting system , i usually face convergence problems with that , the walls...
27 June 2024 9,492 0 View
