How to see Swiss-Doc results in ChimeraX?

23 July 2023 0 7K Report

want to visualize SwissDoc protein-ligand docking results in ChimeraX.

Badges
Science topic

Similar topics
Social Psychology
Attitude

More Khawar Sohail Siddiqui's questions See All

Forecasting with known copula parameters?

I want to calculate the Mean absolute percentage error (MAPE) for my copula model. I am stuck at the forecasting step. I am not specifying the copula here for different data pairs. 1. I have two...

14 July 2024 7,604 1 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,776 1 View

How to generate data from copula parameters for forecasting and model comparsion?

Hi, I have parameters of time-varying normal copula. Now I want to forecast using these parameters. For that I will need to generate data using these copulas parameters as shown in the...

20 May 2024 488 0 View

How can i check whether urea/denaturant has been removed from my protein after dialysis ?

i am refolding protein by gradient dilaysis in which i gradually decrease concentration of urea by gradient dialysis. however im not getting surety wheather denaturant has been completely removed...

24 April 2024 5,399 1 View

For copula modeling of time series data, why are standardized residuals of fitted ARIMA/GARCH required instead of directly using time series data?

Hello, I have read that for standard copula modeling, you can get empirical cdf of data and use it for copulas. But for time series data, we must first fit ARIMA/GARCH, get standardized...

11 February 2024 2,463 1 View

Time Varying copulas Empirical analysis steps?

Hello, All papers I have read about time-varying copulas just produce tables, but none explains exact steps for empirical data. How do I calculate the time varying parameters for the copula? I...

18 December 2023 5,453 1 View

Can someone please suggest me a protocol for Electrophoretic mobility shift assay (EMSA)?

I have to check that whether my purified protein interacts with DNA for which i need to perform an EMSA. I am unable to design this experiment properly so need some tips and suggestions. Thankyou...

04 December 2023 3,864 0 View

Can someone explain that why my 0.7% agarose gel takes 2 hrs to run and also some suggestions on cloning for bacterial two hybrid experiment?

I am doing cloning of a big bacterial insert (3705bp) into a vectors of varying sizes ranging from 3017bp to 3469bp for my bacterial two hybrid experiment. Among other problems with my cloning I...

15 November 2023 7,101 4 View

How to prepare the Torodial shape sample of Mechanically Alloyed FeCoNiAlMn1-xCrx High Entropy Alloy Powders?

I have 6 different powder samples of Mechanically Alloyed magnetic High Entropy Alloy Powders as FeCoNiAlMn1-xCrx (x=0,0.2,0.4,0.6,0.8,1). I need to measure there microwave absorption properties...

24 July 2023 3,412 0 View

Is it possible to plot the atom-projected band structure using GPAW?

Hi, I'm currently working on a project where I need to plot the atom-projected band structure using GPAW. I've been able to calculate the band structure for my material, but I'm having trouble...

07 August 2024 267 3 View

Why does everyone use vs code?

Visual Studio Code (VS Code) has become a popular choice among developers for several reasons: 1. **Free and Open Source**: VS Code is free to use and open source, making it accessible to...

07 August 2024 7,013 4 View

Can anyone provide me with molecular docking softwares/ websites?

Molecular docking software/ websites?

02 August 2024 8,704 7 View

AutoGrid and Autodock 4.2.6 window opens for 1 second then closes and there is no output files?

Good day, I am a student trying to work on Autodock for a project regarding Ligand-DNA interaction so i am quite new to molecular docking. i have followed tutorials and did all the steps...

28 July 2024 2,136 4 View

Is it possible to dock more than one drug in the same active site or pocket of a protein to study synergistic/antagonistic/additive properties?

I wanted to know whether we can observe the synergistic/antagonistic/additive properties of combinations or mixtures of compounds through docking analysis. But during docking preparation any...

28 July 2024 7,413 6 View

Can you visualize platelets using EVOS ?

Hi all, My lab has Thermo Scientific™ Invitrogen™ EVOS™ FL Auto 2 Imaging System, and I was wondering if I will be able to use it with whole blood, whilst focusing on platelets? The idea would...

24 July 2024 9,337 3 View

What is the main factor involve in higher binding score performing molecular docking?

A molecule shows the -11.6 kcal/mol and second one -8.0 kcal/mol so why molecule (A) revealed higher binding score. Please explain major factor involve in it.

21 July 2024 954 5 View

In silico can we join two ligands for docking....?

I have performed docking of proteins with two ligands, both ligands show affinity. I want to check the effect if we join both ligands and perform docking

20 July 2024 2,653 2 View

How can I determine if a drug binds to a ribosome using a Cryo-EM map?

Hello, I am searching for the binding position of a drug in a ribosome, based on previous work indicating it binds there. The resolution of the ribosome-drug Cryo-EM map is around 2.5 Å. I've been...

19 July 2024 2,155 0 View

How to extract binding energy from pv.maegz file without using Schrodinger?

I have conducted virtual screening using Schrödinger on a database of 17,000 molecules. Unfortunately, I cannot use the system with the Schrödinger license at the moment. I am trying to find a way...

18 July 2024 2,881 4 View