want to visualize SwissDoc protein-ligand docking results in ChimeraX.
I want to calculate the Mean absolute percentage error (MAPE) for my copula model. I am stuck at the forecasting step. I am not specifying the copula here for different data pairs. 1. I have two...
14 July 2024 7,604 1 View
can any budy explain how i calculate the DNA concentration for the 50ul reaction?
22 May 2024 9,557 1 View
If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...
22 May 2024 7,777 1 View
Hi, I have parameters of time-varying normal copula. Now I want to forecast using these parameters. For that I will need to generate data using these copulas parameters as shown in the...
20 May 2024 488 0 View
i am refolding protein by gradient dilaysis in which i gradually decrease concentration of urea by gradient dialysis. however im not getting surety wheather denaturant has been completely removed...
24 April 2024 5,399 1 View
Hello, I have read that for standard copula modeling, you can get empirical cdf of data and use it for copulas. But for time series data, we must first fit ARIMA/GARCH, get standardized...
11 February 2024 2,463 1 View
Hello, All papers I have read about time-varying copulas just produce tables, but none explains exact steps for empirical data. How do I calculate the time varying parameters for the copula? I...
18 December 2023 5,453 1 View
I have to check that whether my purified protein interacts with DNA for which i need to perform an EMSA. I am unable to design this experiment properly so need some tips and suggestions. Thankyou...
04 December 2023 3,864 0 View
I am doing cloning of a big bacterial insert (3705bp) into a vectors of varying sizes ranging from 3017bp to 3469bp for my bacterial two hybrid experiment. Among other problems with my cloning I...
15 November 2023 7,101 4 View
I have 6 different powder samples of Mechanically Alloyed magnetic High Entropy Alloy Powders as FeCoNiAlMn1-xCrx (x=0,0.2,0.4,0.6,0.8,1). I need to measure there microwave absorption properties...
24 July 2023 3,412 0 View
Hi, I'm currently working on a project where I need to plot the atom-projected band structure using GPAW. I've been able to calculate the band structure for my material, but I'm having trouble...
07 August 2024 269 3 View
Visual Studio Code (VS Code) has become a popular choice among developers for several reasons: 1. **Free and Open Source**: VS Code is free to use and open source, making it accessible to...
07 August 2024 7,013 4 View
Molecular docking software/ websites?
02 August 2024 8,704 7 View
Good day, I am a student trying to work on Autodock for a project regarding Ligand-DNA interaction so i am quite new to molecular docking. i have followed tutorials and did all the steps...
28 July 2024 2,136 4 View
I wanted to know whether we can observe the synergistic/antagonistic/additive properties of combinations or mixtures of compounds through docking analysis. But during docking preparation any...
28 July 2024 7,413 6 View
Hi all, My lab has Thermo Scientific™ Invitrogen™ EVOS™ FL Auto 2 Imaging System, and I was wondering if I will be able to use it with whole blood, whilst focusing on platelets? The idea would...
24 July 2024 9,337 3 View
A molecule shows the -11.6 kcal/mol and second one -8.0 kcal/mol so why molecule (A) revealed higher binding score. Please explain major factor involve in it.
21 July 2024 954 5 View
I have performed docking of proteins with two ligands, both ligands show affinity. I want to check the effect if we join both ligands and perform docking
20 July 2024 2,653 2 View
Hello, I am searching for the binding position of a drug in a ribosome, based on previous work indicating it binds there. The resolution of the ribosome-drug Cryo-EM map is around 2.5 Å. I've been...
19 July 2024 2,155 0 View
I have conducted virtual screening using Schrödinger on a database of 17,000 molecules. Unfortunately, I cannot use the system with the Schrödinger license at the moment. I am trying to find a way...
18 July 2024 2,881 4 View