Is that peel cells or epicuticle wax layers?

Hafiz Muhammad Rizwan @Hafiz-Rizwan

21 August 2019 0 9K Report

Dear Researchers,

I did scanning electron microscopy (SEM) of the fruit peel and founded different structure during SEM,

Are these peel cells (box like) or epicuticle wax cells/layers?

Badges
Science topic

Similar topics
Filing

More Hafiz Muhammad Rizwan's questions See All

I'm interested to quantify Urea by HPLC method, reversed phase conditions are preferable. Is there a good method suited for urea?

I have to develop a method that can be good enough to run dozens of samples that include urea as the main compound. I prefer an HPLC method because of the convenience of running large numbers of...

01 February 2021 1,888 4 View

How to convert ng/ul of DNA concentration to pmol/ul ?

Dear researcher, After amplifying my target gene (1900bp) into the required cDNA by PCR,>cut specific gel bands and purify the gel and the concentration was 30ng/ul. Next, performed A-Tailing...

21 January 2021 2,671 3 View

Can use Unigenes from RNA sequences for overexpression studies (transformation) without requiring a specific plant genome?

Dear researchers: If the plant genome has not been released yet, can Unigenes from RNA sequences be used after BLAST and confirmed with known Arabidopsis genes for function/overexpression...

20 January 2021 5,557 2 View

What is the reason of weight gain in TGA curve of a HDPE polymer sample ?

HDPE samples were aged at higher temperatures in the presence of water and CO2 than the TGA test was performed in Nitrogen? Weight gain is seen in the curve? What could be the possible reason for...

16 January 2021 5,644 2 View

Can BLAST/ search by using known Domain in Transcriptome/Genome data for a gene family?

Dear Researchers, I have Transcriptome/Genome data and want to list all the member of a KCS/CER gene family whose Domain AP2/ERF, FAE1_CUT1, according to the Arabidopsis database, so is there...

15 January 2021 2,293 3 View

Is it necessary to measure the concentration of PCR/Gel purified product for A-tailing and TA cloning?

Dear Researchers, While working on plant gene transformation, so after cDNA + Gene Primer amplification, >the PCR/Gel were purified, so next for A-tailing and TA cloning is mandatory to...

12 January 2021 3,272 34 View

Can use the same vector for overexpression and transient expression?

Dear Researchers, I am using pCAMBIA1301/1302 vectors for overexpression study, so can use the same vectors for transient expression? or need to design another vector for transient expression;...

08 January 2021 7,975 2 View

Why negative controls also showing the specific bands of promotor and other regions (GUS, GFP etc.)?

Dear Researchers, I did a transformation of an empty vector (pCAMBIA1301/1302) into my passion fruit plants, for the optimization of the transformation protocol. After transformation; DNA...

06 January 2021 8,465 99 View

Can anybody help me out in TRNSYS about short term thermal energy storage used as buffer storage ..?

i am a beginner in trnsys and need help ... can anyone please guide me

20 December 2020 1,040 3 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10?

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10? Since, the growth curve from day 2 to 10 won't be like the "Logistic curve" it might not follow logistic...

03 March 2021 1,401 3 View

Does any one know how i can prepare liver tissue with transmission electron microscope with good fixation?

i have problem in preparation of liver tissue with bad cell organelles and how i can adjust osmolarity

03 March 2021 8,890 1 View

After a reference from Int J Body Compos Res, can any body help?

Hi, I am after the reference below, my library says it cannot obtain a copy either locally or internationally, any help appreciated! Chris Wang ZM, Heshka S, Wielopolski L, Pi-Sunyer FX, Pierson...

03 March 2021 6,193 1 View

What techniques can I use to determine the miscibility of polymer blends?

The term miscibility refers to the single-phase state in thermodynamics. I do not mean the compatibility of different components. To determine the miscibility I know several techniques such as...

03 March 2021 4,107 4 View

I need to image mesoporous silica nanoparticles that are in ~100 nm size and do high resolution TEM to look at mesopores. what grids should I use?

Need to image mesoporous silica nanoparticles using the TEM. Also, need high resolution TEM images to see the mesoporous structure. Kindly suggest what kind of grids to use. Thanks, Shatadru

02 March 2021 1,787 2 View

Is There Any Feasible Method To Test Fluorescent Compounds Other Than Fluorescence Spectrometers ??

Is There Any Feasible Method To Test The Efficiency Of Fluorescent Compounds Other Than UV Spectrometers ? Suggestions Would Be Appreciated !

02 March 2021 5,785 3 View

How to repeat an operation on an atom selection for multiple times in PyMol?

Hi, I am trying to construct a multi-layer fibril structure from a single layer in PyMol by translating the layer along the fibril axis. For now, I am able to use the Translate command in PyMol...

02 March 2021 4,569 4 View

Shall I skip the measurement model in SmartPLS?

Hello everyone, I had run a mediation model in SmartPLS using questionnaires that were already validated among my statistical population. A professor who edited my paper -though she is not...

01 March 2021 3,052 3 View

What is involved in morphological changes of SEM images of a substance?

In the sem analysis of CaCO3 nanaoparticles, the morphology images showed spherical shaped particles but the proposed morphology for these type of nanoparticles is trigonal. I prepared the...

01 March 2021 1,960 4 View

I have designed reflectarray element and feeding it though Horn Antenna on HFSS. After full wave simulation, I am not getting desired results?

I have designed reflectarray element to generate OAM beams at 5.8GHz and feeding it though Horn Antenna on HFSS. After full wave simulation, i am not getting desired results i.e Radiation pattern...

01 March 2021 9,701 5 View