Goodmorning,
I have a biomolecular dilemma that i can't answer.
We would like to produce a fusion construct that is composed by two proteins in tail-to-tail conformation, otherwise one of the two in not functional.
At molecular level, I have some doubt because If i flip (5' to 3', see example below) the aminoacids sequence of one of the proteins, then this sequence doesn't blast to anything anymore.
Does anyone has some experience in this kind of cloning?
More in general, does the flipping affect the expression/folding of the aa sequence?
Thanks!
Hi Filippo,
Flipping you DNA sequence will not result in the protein A having the reversed (N to C) amino acid sequence.
e.g. for a sequence 5 atgtctgttaacttaggtgcatta 3 you get MSVNLGAL peptide. If you flip it (promoter is kept upstream of the 5'end) you get taatgcacctaagttaacagacat thus stop- CT-stop-VNRH sequence.
If you flip the coding strand (so totally different DNA would need to be synthesized) you get attacgtggattcaattgtctgta you get ITWIQLSV peptide.
On the other hand, if you flip the entire coding sequence the way it is drawn in the bottom part of the panel (now the promoter would be somewhere between A and B), then you get a protein with exactly the same sequence as in top part, because the translation again proceeds from N to C terminus.
Hello Mrs Ana Crnkovic
I think this video may be help you get information about BLAST techniques and its types :
https://www.youtube.com/watch?v=bL-GnXJHdek
Hi there,
Your question is confusing... What are you looking for? Expressing a fusion protein from a unique promoter which is upstream of ProtA coding sequence? If so and as mentioned above, DNA and polypeptides are asymetric molecules so the construct you are looking has to be clearly defined first. If your intention is to express a fusion where DNA coding ProtA has been only flipped then protein sequence will be very different from what you showed in the joint picture. If your intention is to keep the aa sequence and just changing its polarity then you have to design a new gene...
Thanks for the answer,
Sorry if my question bit confusing.
The aim is to produce a fusion protein where one of the two components it flipped at aminoacids level (we need a tail to tail conformation). The full construct will be produced under a single promoter and, of corse, the nucleotide sequence of the flipped protein will be re-synthesised from scratch to produce the correct sequence of aa.
My question concern the functionality of the final flipped protein, in the sense:
is the protein "EDHHSTVDPN..." equal to "...NPDVTSHHHDE"?
Thanks again fot help
Reversing the amino acid order will result in a protein that is different from the original one both structurally and functionally. IMO it is unlikely to be functional at all.
Due to the chirality of amino acids (L-...), I'd expect funny results (at least not what you are expecting). Probably your construct even will result in a different tertiary structure for the reversed part. On the DNA level, you have to reverse the triplet sequence, so you'll need to have your cDNA synthesized from scratch (IMHO the only reasonable way to get there).
Thanks for the suggestions.
It looks quiet difficult to achieve a functional protein with this approach, I will have to think something else.
Filippo Massa In principle, it is possible to flip your ProtA amino acid sequence. Just need to design and synthesize a new gene sequence encodes for flipped amino acid sequence plus your original ProtB sequence. It's interesting to see the result. It would be a useful experiment.
- Badges
- Science topic
- Similar topics
- Computer Science
- Program