I want to fuse my gene of interest with EGFP and mCherry for localization studies. I am wondering if immdiate presence of mCherry or EGFT after my protein of interest would cause any steric hindrance on my native proteins?
If yes, then can it be avoided by using any flexible linker?
Dear Vikas
steric hydrance is a possibility when yuo fuse two proteins and addiction of a linker whose allow them to indipendently fold is preferable.
Which linker and how long? it depends from the nature and size of the proteins that you would like to fuse and the use of the proteins.
For example in vaccinology generally we try to use short linkers as gsggg ( flexible not structured) or AEAAAKA ( structured alpha elix) GGSLVPRGS (rigid not structured) to minimize their immunogenicity.
In my experience in the most cases the first (GSGGG) work well and sometimes if i observed protein degradation was due to the degradation of one of the attached proteins and not of the fragment.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3588912/#!po=0.454545
if you fuse big proteins could be better to use more long linkers to make the 2 proteins able to indipendetly move and avoiding that one part of a patner cover an important site of the other.
unfortunatelly there is no solution valid for all cases..
When for example de design a construct for perform recombinant protein expression and purification often the protease cleavage site is the linker or is it part of it.
good luck
Manuele
Dear Vikash,
It is advisable to put linker between two proteins to avoid steric hindrance, which will help them to fold independently. I used following sequence as linker to express POI-eGFP protein in-vivo. N to C: ggaggtggctctggcgggggatca
Good luck
Prem
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Biology