I try to clone entire Open Reading Frame of one of the proteins that I am studying and designed two sets of primers from 5'UTR and 3'UTR ( one I designed and one I got it from NCBI database). Every time I do PCR I have a difficulty getting right product size (2357 bp). Instead I get many other bands that are unspecific. when I decreased Tm I seem to have my product size, but with many other bands it is hard to excise from the gel. But when I increase the Tm I loose that supposedly correct band.
Here are my PCR settings : 95-3 min, (95-1min, 61-45 sec, 72-2 min) 40 cycle, 72-10 min.
Attached file contains my cDNA sequence (Mouse Radial spoke head like protein; Rsph6a) and my designed primers.
Please feel free to drop any comments or suggestions how can I improve my specificity of my primers when designed in UTR regions. OR are there any alternative ways to overcome this problem.
Thank you
Hello Dr Bidur Paudel,
I would have some suggestions to propose to you that, maybe, could improve your PCR amplifications.
Here are the sequence of the primers you use (I assume that the 5' is at left and the 3' at right):
F: AACGGTAGGCAGGCAGGGTC
R:AGCTGTGCTGGGGCAGTTTT
NCBI Primers: F: CAGGATAGGGCAGCACACTTT
I didn't find in your text file the other reverse primer ...
1) First fo all, the two last primers miss a GC-clamp at their 3'-end. The GC clamp means a series of at least three Gs or Cs (i.e. GGG, CCC, GCG, CCG etc.). To introduce a GC-clamp (of course respecting the target s quence so that could require to make a somewhat longer primer) , frequently improve greatly the specifciity of the PCR amplification. I frequently obseve it myself (I PCR-amplified something as several hundreds of ORFs).
2) The three primers al shows similar Tm at 64°, 63° and 60°, respectively. I strongly encoruage you to write longer primers with more Gs and Cs in order to lower somewhat their Tm values.
3) If you still face unspecific amplifications, you could simply add tetramethylammonium chloride at 50 mM final concentration in your PCR incubation mixtures. I frequently got surprising improvment in specificity in doing so.
Best regards and GOOD LUCK for your experiments!
Philippe
did you retrotranscribed your mRNA starting from an oligo dT primer or by a 3' most sequence specific primer ? this could reduce complexity of your cDNA.
in my experience, for PCR: not exaggerate with the amount of template (your cDNA). Most of the time "less is better" to avoid extra products. denaturation of 30 sec. usually is more than enough to open dna strands, preserving the enzyme efficiency along the reaction. Same for the annealing (30 sec), especially if the melting Temp of the primers is well balanced. Theoretically the enzyme synthesis rate is roughly 1000base/minute but its efficiency depends also by the stressing condition of the reaction (you run 40 cycles so you could reduce cycles or increase the time of extension from half reaction on ). moreover, if you need to clone your product, you don't need large amount of it and even if your reaction is not perfectly clean you could run a good gel separation (10 ul onto a 1.2% agarose gel, run slowly, 80 V) cut the band, extract it with quiaquick gel extraction or any other commercial product and I think you will have enough material to check your band by a round of sanger and than clone clone it.
sincerely
Michele
The GC content of your intended product is somewhat high (59.8%), and it is quite long so you may need to boost the denaturation temperature in each cycle to improve the efficiency of amplification. The NCBI primer set is exactly the one that is selected by Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/primer3/). Analysis of the other set of primers by Primer3 finds some possible issues:
Using mispriming library rodrep_and_simple.txt
Using 1-based sequence positions
WARNING: Left primer is unacceptable: Tm too high/High 3' stability; Right primer is unacceptable: Tm too high
OLIGO start len tm gc% any 3' rep seq
LEFT PRIMER 1 20 65.83 65.00 3.00 1.00 11.00 AACGGTAGGCAGGCAGGGTC
RIGHT PRIMER 2316 20 64.42 55.00 4.00 0.00 10.00 AGCTGTGCTGGGGCAGTTTT
However, if both primer sets are giving you the same problem, then I would first try raising the denaturation temp/time. Another option which can help with high GC content amplicons is the addition of 1M betaine.
Other possible strategies include amplifying the cDNA as two (or more) overlapping fragments and then piecing them together with fusion PCR or Gibson reactions.
Thank you all for the the useful comments and suggestions. I have designed a new set of primer and planing to approach my experiment considering all your comments.
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Biology
- Molecular Biological Techniques