Is anyone familiar with 30 nucleotide peak in small RNA libraries?

Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence?

I am on the lookout for the Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence. Does anyone know where I can find it? Thank you in advance

03 March 2021 3,568 1 View

Gel electrophoresis result for total RNA samples, 1.5 Agarose gel was used, How to improve the integrity of RNA?

Gel electrophoresis, RNA degradation, RNA extraction from fresh tissue

02 March 2021 5,433 5 View

Is it possible for two human neuronal cell lines to have different gene sequence for the same protein?

I am looking at the ATP1A2 (Sodium/Potassium ATPase alpha subunit 2) in two human neuronal cell lines. Expression levels of this protein seems to be almost equal when detected by one antibody....

01 March 2021 3,607 3 View

Problem with shRNA transfection. Why are only two plates getting contaminated instead of all?

I transfected my LNCaP-WT cells with 3 shRNA plus their NTC two weeks ago and split two puromycin selected cell plates on Friday last week(Feb 26). I checked for GFP in the cells, and they all...

28 February 2021 4,949 3 View

Why am I not able to use all VEP programs for the in silico analysis of avpr1b SNP's?

Good day researchers I am busy analysing the predicted effects of certain SNP's in AVPR1b. When using the VEP prediction programs (SIFT, Polyphen, FATHMM, LRT, Provean, Mutation Assessor, and...

28 February 2021 5,197 1 View

What is the difference between genotype and haplotype data in the ped format?

Hi everybody In the ped format for genotype, alleles of any SNP are represented by two columns (one for each allele, separated by a space). Is a column sufficient for the haplotype to...

27 February 2021 1,965 1 View

Any specific pipeline or parameter to analyse total transcriptomics study of brain tissue samples?

I have two groups of brain samples, control and treated for example. It was total RNA nova seq sequencing. I tried all the available pipeline like: star+rsem+deseq2, Hista+stringtie+cuffdiff,...

27 February 2021 356 6 View

Why is the efficiency of viral mRNA electroporation in PBMC low?

Hello, I have been struggling with the electroporation of PBMC with HIV-I mRNA. Although the quality of the RNA generated is good, and the handling of the cells in meticulous, the frequency of...

27 February 2021 9,233 3 View

Runs of nucleotides in Sanger sequencing?

I performed site directed mutagenesis, transformation, and then I sent out plasmids for Sanger sequencing and found out that there is extension of DNA just before the stop codon. I am not sure...

27 February 2021 547 3 View

Has anyone used the Illumina ITS1 primer sets?

Hi everyone, Illumina provides a list of primers to amplify with high taxonomic coverage the ITS1 region for further fungal sequencing, but I cannot find the exact amount necessary of each...

25 February 2021 6,969 3 View

Nicholas Mueth

They seem to match protein-coding sequences from my organism. Another clue: the most abundant reads at each length are reverse-complements of one another. For example, these are the two most abundant sequences at 30 nt:

GCGTTGTTAGGCTAGCGGTAAACTGGGGCC

GGCCCCAGTTTACCGCTAGCCTAACAACGC

These match two different hypothetical proteins in the sense (+) orientation; of course they also match each other in the antisense (-) direction.

ke Wang

You must already come out the answers,so let me guess.How about piRNA which is usually 26~32bp in length and the ping-pang pathway during piRNA biogenesis always leading to reverse-complement piRNA.