I need a subject to write a review article, who can suggest me a subject?

More Fateme Shateri's questions See All

Is this a facetotecta nauplius?

This larva was captured using a plankton net in the Persian Gulf during the summer. I believe it may be a Facetotecta nauplius.

08 August 2024 3,746 4 View

How to use CINPE4 elements in ABAQUS for infinite boundaries?

Hi All, I have used infinite elements in Abaqus to absorb waves at the sides and bottom boundaries of the soil domain. but the boundary reflected wave can not be completely absorbed on the...

06 June 2024 448 4 View

How merge output files of simulation with NAMD?

I have been running steered molecular simulation with NAMD, but in the middle of my simulation it has stopped and i have restarted from specific steps which had stopped. Finally i have two parts...

19 May 2024 1,483 2 View

What is the reason of pattern of lithography in center of wafer are thicker in comparison of edges of the wafer?

Hello When we pattern a mask in a wafer, after exposure we noticed that the length of our patterns in the center of our wafer is thicker in copmarison with edges of it. What is the reason and...

22 April 2024 6,796 4 View

Why exon number change by zooming out in Genome Browser?

Why does the number of exons of PTPRQ change by zooming out in Genome Browser site? the NM number is: NM_001145026.2

21 April 2024 8,336 1 View

No matches result in silico PCR at Genome Browser webpage!?

I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009...

06 April 2024 3,951 4 View

What is the role of surface tuxture in anti gravel coatings?

Anti gravel or stone chip resistant coatings are often defined as textured coatings. Does the tuxtured surface play a role in the coating performance, especially in anti gravel properties?

22 March 2024 7,758 0 View

Have you ever run a steered molecular dynamic simulation with NAMD?

Hi everyone. Is there anybody here who have run a steered molecular dynamic simulation with NAMD and knows about the parameters which i have to write in my configuration file?

05 March 2024 7,935 1 View

How can the bitter taste from calcium chloride treatment in a protein product be minimized while maintaining the desired texture?

Greetings esteemed colleagues, I am currently working on my master's thesis, focusing on a protein product that requires the use of calcium chloride treatment in one of its stages to form calcium...

24 February 2024 1,806 2 View

How could i minimize and equilibrate system with available output files of CHARMM-GUI for NAMD?

I have downloaded output files of CHARMM-GUI for NAMD which i had made membrane-protein complex with CHARMM-GUI and now i don't know what should i do with these files before running simulation...

13 February 2024 4,182 0 View

I need JCPDS file of LSFCO nanomaterial. Can anyone provide me?

Require for Rietveld refinement in XRD.

08 August 2024 3,081 2 View

How to report results of Generalised Linear Mixed Models in a journal article?

Hi everyone, If you have written or come across any papers where Generalised Linear Mixed Models are used to examine intervention (e.g., in mental health) efficacy, could you please share the...

04 August 2024 4,130 4 View

The question is how to use Wavenet transform?

HOW CAN I WRITE A CODE TO USE THE WAVENET TRANSFORM AS A FEATURE EXTRACTION METHOD INSTEAD OF DWT IN MATLAB?

03 August 2024 7,829 0 View

Radiogenomics Cancer Research Challenges?

what are the top 3 challenges to the advancement of the field of Radiogenomics in cancer research? is it the availability of easily available low-cost matched imaging and biosamples with clinical...

03 August 2024 5,828 4 View

PhD thesis topic?

I want to write a topic for my PhD thesis in hospitality (hotels), can u please suggest some variables

29 July 2024 9,058 3 View

What are the main types of errors and causes that English major college students commit in their English writing?

a 15-page paper

29 July 2024 1,956 5 View

I did hirshfeld surface analysis for molecule but did not find red spot and interaction surface in energy frame work, is it ok for research article ?

In hirshfeld surface calculation i did not find any red spot in hirshfeld surface, is it ok for research article to write?

28 July 2024 2,988 0 View

How can I find writers for drafting, submitting, and publishing papers?

Looking for paper collaboration writers： Collaboration Model 1: 1.1 Based on the chosen topic, complete the paper writing, select an SCI or SSCI Q1 journal, submit using my QRCID, and complete...

27 July 2024 8,965 1 View

Given currenct advances in the AI and Smart Computation, what are the prospects of having truly Humanoid Computing Devices in support of Education?

Today, many priorities for improvements to teaching and learning are unmet. Educators seek technology-enhanced approaches addressing these priorities that would be safe, effective, and scalable....

26 July 2024 8,544 4 View

What are cultural bereavement practices of Jamaica that do not conflict with the Christian faith?

I am writing my thesis on the enculturation of Jamaican grief and bereavement practices that enhances their Christian faith and not diminish it.

23 July 2024 3,837 0 View

Malcolm Nobre

Hello Fateme Shateri

I can suggest two titles.

1. Exploring Paclitaxel-based Nanostructures in the Treatment of Ovarian Cancer.

2. A Promising Review on Paclitaxel-based Nanostructures for Ovarian Cancer Treatment.

The below references will help you to begin. These are just a few interesting articles. You may have to refer to quite a few more before you submit the final manuscript.

https://www.sciencedirect.com/science/article/abs/pii/S0168365919305188

https://pubs.rsc.org/en/content/articlehtml/2022/ma/d1ma00961c#:~:text=Lately%2C%20numerous%20PTX%20nanoformulations%20have,while%20also%20sparing%20normal%20cells.

Article Targeting Paclitaxel-Loaded Nanoparticles to Ovarian Cancer

Article Nanotechnological approaches for diagnosis and treatment of ...

https://www.frontiersin.org/journals/pharmacology/articles/10.3389/fphar.2024.1344855/full

Article New trends in diagnosing and treating ovarian cancer using n...

Article Paclitaxel: Application in Modern Oncology and Nanomedicine-...

Good Luck!

Raja Velusamy

To write a review article, consider selecting a topic based on recent advancements in your field or gaps in existing research. Our website provides comprehensive guidance on choosing a subject, formulating a hypothesis, and selecting the right tools for your research. You can explore detailed resources here - https://researchbrains.com/research-in-future/ and https://researchbrains.com/recent-research-updates-3/.