Hi
I recently designed a couple of primers to amplify viral genes.
When I run agarose gels to observe amplicons, I did not observe anything. I already made temperature gradients and nothing. For the PCR I am using this control https://www.vircell.com/producto/amplirun-total-respiratory-viral-panel-control-swab/ and i made cDNA in two steps. These are my primers i hope someone can help me
F- ACTTCAAATACCCAGCATTGAACGT
R- TGGTACATTTCGCATCCCTGTTG
F- CTCTGAAATTGGCAACAGGGATGCG
R- ACAACCATTGCCCATATCCTCAGCA
Influenza A virus (A/Perth/16/2009(H3N2)) segment 4 hemagglutinin (HA) gene, complete cds
GenBank: GQ293081.1
Hello Dr. Posadas. Control RNA extraction is done through trizol-chloroform method. cDNA synthesis was carried out using oligo dt in the two-step reaction. I'm about to test cDNA synthesis with Gotaq probe 1-step RTqPCR system kit, hoping this will work. Do you think it would be better to use hexamers?
thanks for your attention
The RNA from virions or infected cells?
If you extract the RNA from the virions (supernatant from infected cells), you would need the commercial kit (qiagen viral mini kit). Trizol-chloroform not works well (need adding carrier RNA).
This is the whole story. I designed six primer sets for the viruses I mentioned in my first comment. Till now I have amplified 3 that are H1N1, parainfluenza 2 and paranfluenza 3. These 3 amplified me using oligo dt, however, they amplify much better using hexamers. The case of influenza A, influenza B and parainfluenza 1 I have not yet been able to obtain any amplification. My question is about the control, since H1N1 and parainfluenza 2 are annotated as complete genomes, while the rest that I have not been able to amplify are indicated as partial sequences, what does partial sequences mean? I would like to mention that among those indicated as partial sequences comes parainfluenza 3, which I could already amplify.
I do not know what else to do. Thank you for your answers.
Dr. Posadas, I appreciate your advice, the cDNA synthesis with forward primer worked very well. Thanks for answering my questions.
Muchas gracias