Designing 16S primers specific to cetrain type of bacteria can be really tricky business, you'll almost always get multiple hits for other bacteria. If the genome sequence is available then I recommned finidng a not very conserved gene or region on the genome that is specific to the bacteria you're working on then design primers to that specific region/gene. Then after that the qPCR should be straight forward. You will have to do absolute quantification to get the copy number which means that the gene you use to generate a qPCR standard curve better be cloned in a plasmid and quantified very carefully to ensure that you get a single copy in your standard curve.

i hope that helps

Dear Ann

do you have a specific 16S rRNA ID or sequence that you can share?

The ARB project, http://www.arb-home.de/ has tools specifically designed for designing primer sets and identifying what other groups they may target and is more accurate than blast

Designing 16S primers specific to cetrain type of bacteria can be really tricky business, you'll almost always get multiple hits for other bacteria. If the genome sequence is available then I recommned finidng a not very conserved gene or region on the genome that is specific to the bacteria you're working on then design primers to that specific region/gene. Then after that the qPCR should be straight forward. You will have to do absolute quantification to get the copy number which means that the gene you use to generate a qPCR standard curve better be cloned in a plasmid and quantified very carefully to ensure that you get a single copy in your standard curve.

i hope that helps

Dear Michael, the sequence I used til now is the following: https://www.ncbi.nlm.nih.gov/nuccore/HM037995.1

Dear Waleed, thank you. So it wouldnt be sufficient to normalize it to a common 16S rRNA primer pair which detects highly conserved regions found in all bacteria?

Ok, according to the sequence of linear DNA HM037995.1 (which is also the linear rRNA under the reference of NR_104907.1)

this pair looks good to me

F: GACGAGCTTGACGAACGATTCT

R: TGAAGGGCAGGTTGCTCACG

blast results:

https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1528745883&job_key=DwXQXW-wYhhFInQneUdQFQNcQScuT1o6Lw

you can blast it yourself if you're using a specific database to make sure

but I really can't see the need for this specific gene, I'm curious to know what type of comparing between the sample are you using next.

I agree with Waleed. If you want species-specific primers, target a protein-coding gene. Even if there isn't a genome sequence available, there are likely to be gene sequences available. It's a good idea to pick a gene that has been sequenced a number of times in order to make sure that you target a region that is conserved within the species. I usually make an alignment of the available sequences of the target genes within the species and their homologs in closely-related species and look for regions that are conserved within the species but different in the related species.

Unless you know of a gene that is characteristic for your species, try to stick to housekeeping genes and stay away from genes that are likely to be horizontally transferred.

Good luck

Andrew

agree with @ Waleed Albihlal

regards

For house keeping gene which I assume that you mean that it is the gene you will be using to generate the standard curve, it is fine to use 16S as long as you don't amplify that directly from E. coli or any other species because this will complicate the calculations a bit. Make sure that you clone the housekeeing gene in a plasmid, purify the plasmid and quantify it using accurate means such as PicoGreen assay or Qubit. Then you're ready to make your standard curve.

I respectfully disagree with Waleed, about the use of a plasmid clone. I would advise against making a plasmid clone for your control, unless you absolutely need to. It's easier to use a high-quality genomic DNA prep of your target bacterium. If you know the approximate genome size, it's easy to calculate the copy number in genomic units per ml.

Plasmid preps have template concentrations that approach those of amplified samples and they present the same contamination risks. They're a headache in a PCR lab, because they don't really belong in the post-PCR lab and they can't be safely handled in the pre-PCR lab. I only use plasmid controls when I can't get a pure sample of genomic DNA and when I do have to use them, I get them synthesised, rather than preparing them myself, in order to minimise contamination risks.