How to find the promoter sequences of any gene?

More Dr Binod Kumar Yadav's questions See All

Can anybody send me the sequences of promoter of Mus musculus Drd2 and STMN1 which has maximum Luciferase activity and any reference in this regard ?

11 December 2015 7,764 0 View

Does the PC12 cell line always need NGF or can it be cultured with RPMI or DMEM with FBS and antibiotic(Penicillin)?

Is PC12 cell line always need NGF or It can be cultured with simply RPMI or DMEM with FBS and antibiotic(Peniciline)?

10 November 2015 7,051 8 View

How can I measure MMP-1 protein activity or protein level from liver tissue?

Instead of checking only the mRNA level, I want to check the active protein level of MMP-1 in Liver tissue from mice. How can I do that?

03 March 2021 1,763 2 View

Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence?

I am on the lookout for the Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence. Does anyone know where I can find it? Thank you in advance

03 March 2021 3,568 1 View

IHC on mouse liver hepatocytes?

Can anyone help me choose primary antibodies for mouse liver hepatocytes and also in conjunction Cd8 cells. Also Cd3 cells. I want to look at hepatocytes and adjacent immune cells in mice with...

01 March 2021 6,953 1 View

Is it possible for two human neuronal cell lines to have different gene sequence for the same protein?

I am looking at the ATP1A2 (Sodium/Potassium ATPase alpha subunit 2) in two human neuronal cell lines. Expression levels of this protein seems to be almost equal when detected by one antibody....

01 March 2021 3,607 3 View

How to avoid ulcers in s.c. injected tumors ?

Recently, we have injected s.c. B16F10 tumor cells in BL/6 mice. At around 12-15th day some animals showed ulcerations in tumors , with a big hole in the middle (it looks like a volcano). We have...

01 March 2021 9,938 3 View

Interested to stain mice tissue with WGA 488 conjugate, anybody has a protocol to recommend?

Interested to stain mice brain tissue with WGA 488 conjugate, appreciate if anyone willing to offer me some guidance or suggestions! Thank you!

28 February 2021 3,951 2 View

Genome-wide gene identification protocol ?

Is there any book chapter/book, webpage or research article available to understand genome-wide gene identification?

28 February 2021 8,095 1 View

Any specific pipeline or parameter to analyse total transcriptomics study of brain tissue samples?

I have two groups of brain samples, control and treated for example. It was total RNA nova seq sequencing. I tried all the available pipeline like: star+rsem+deseq2, Hista+stringtie+cuffdiff,...

27 February 2021 356 6 View

Runs of nucleotides in Sanger sequencing?

I performed site directed mutagenesis, transformation, and then I sent out plasmids for Sanger sequencing and found out that there is extension of DNA just before the stop codon. I am not sure...

27 February 2021 547 3 View

Has anyone used the Illumina ITS1 primer sets?

Hi everyone, Illumina provides a list of primers to amplify with high taxonomic coverage the ITS1 region for further fungal sequencing, but I cannot find the exact amount necessary of each...

25 February 2021 6,969 3 View

Rahul Nitnavare

From NCBI you can retrieve promoter sequence.

1.Search your gene on NCBI and go to graphics and there you will find "TOOLS" tab just click on it.After that you will get some options in that go for "sequence text view".

Copy upstream region of gene.

Dr Binod Kumar Yadav

Thanks alot...but the both ways gives different sequences..so which can be selected for the best.

As per Andrey;this is the sequences..FP004907 Stmn1_1 :+U EU:NC; range -499 to 100. TCACAGGGTTTCGGGCGTTTTAGGCGACCGGGAGGGGTATGGCATCAAAAGGGATATTGCTTAGGGAGCCAAATAAACTCCTATGGCTGGGTAGAGGTAGAGTCCAGTCGGTCGAGGTCTAAAAGAAGTAGGTTAGGACCGACCCCTCCCCTGCTCCTCACCTCGCCCTGCAGTTTTCCTAAAGAGAGTCCCATAACCGATTCAGTCCTGCGGCCGCAGCCAAATGCTCTTCCGATCAGAACACCCCACCCACCCACGCTAGTCCCGGCTAACACCTAGAGAGACCCCCCACCAGGAGTGCCCCACCCCTAGCATTGTCCTCCTGCCCCCCTGGCCCGGACTACAATTCCCGAAATGCTTCTCTCCAGAGAGGCGGTGCTCTCCAGGCTTCGGGGCGGGACTGGCACGTGCCGTCACCCGCAGCCAATGCGGAGCGCCTGGTCTGGGTCACGTGCCGCTGTTTGGCGCTTTTGTGCGCGCCCAGGTCTGTTGGTGCTCAGAGTGTGGCCAGGCGGCTCGGACCGAGCAGGTGGGTGCAGGCTTGGCTTAGGCGGAGGCTACGGCGGGCTGGGGAGCAGCCGGGAACGCGGCGGGTCCCC and as per Rahul..this is the sequences: GCAGCCAATGCGGAGCGCCTGGTCTGGGTCACGTGCCGCTGTTTGGCGCTTTTGTGCGCGCCCAGGTCTGTTGGTGCTCAGAGTGTGGCC AGGCGGCTCGGACCGAGCAGGGCTTTCCTTGCCAGTGGATTGTGTAGAGTATACAGCCAGTCTCTTGTCTTCTGTTCGAC..please suggest..