We've been trying to clone CoupTFII (transcription) in order to generate a probe for in situ hybridization but our transformations only yield white colonies that are restricted along the periphery of the plate, with very few blue blots here and there (if at all). We've trying renewing our LB plates and troubleshooting vector ligation and PCR conditions but none of that seems to help. Any ideas what else we can optimize in order to get a successful miniprep afterwards?
Hi Tando,
No need to clone for probe synthesis ! Do it directly by PCR, it always works and you can choose with part of the mRNA to target.
Select the primers using Primer3 online software and a length of 700-1000nt (don't change the default parameters).
Then add the CGATGTTAATACGACTCACTATAGGG in front of the reverse primer.
Do a first run PCR, extract the band, do a second run PCR, purify, and you are ready for your in situ.
Good luck
Thierry
I forgot to mention le last step : you have now the perfect template for in vitro transcription with T7 RNA pol, and get the probe synthesized.
Thierry
Hi Thierry Gilbert!
I've never considered that before. We are gonna give it a try, while designing new primers in the meantime. We think that the sequence we are trying to clone already exists in the colonies, thus causing the plasmid to be rejected.
I guess we don't have to amplify by cloning, just PCR should suffice. We'll give it a go!
Thanks for this advice!
Dear Emmanuelle Renard
We've tried all those possible, which is why we came to conclusion of redesigning the primers. In the meantime, we'll also try Thierry's advice.
Thanks a mil!
- Badges
- Science topic
- Similar topics
- Human-Computer Interaction
- Collaboration