I want to see polymorphism of Tumour necrosis factor alpha (308 G>A, rs1800629) polymorphism. The sequence of that region is given below:
AGTTCTATCTTTTTCCTGCATCCTGTCTGGAAGTTAGAAGGAAACAGACC ACAGACCTGGTCCCCAAAAGAAATGGAGGCAATAGGTTTTGAGGGGCATG [G/A] GGACGGGGTTCAGCCTCCAGGGTCCTACACACAAATCAGTCAGTGGCCCA GAAGACCCCCCTCGGAATCGGAGCAGGGAGGATGGGGAGTGTGAGGGGTA
So, I need a restriction enzyme which will cut on the bracket region in presence of either adenine or guanine. Most of the articles, I have Found that NcoI enzymes have been used for this purpose.
NcoI enzyme cleaves when this sequence present:
5' C ↓C A T G G 3' 3' G G T A C ↑C 5'But this sequence is not present in the above sequence . Rather the sequence is "GCATGG" As a result when I am using tools to find out restriction enzymes, NcoI enzyme shows" 0" cut. I did not not find any other restriction enzymes also which will cut on that site. So, my questions are: What may be the possible solution? Where I am doing mistakes on searching?
Hi there,
obviously the sequence you provide is wrong! The actual sequence is not GGGGCATG [G/A] but GGGCCATG [G/A] (according to the following paper Article Association of TNF-α-308 G>A (rs1800629) polymorphism with s...
) which results in the presence of one NcoI site if G is present and in the loss of the site if A is present...- Badges
- Science topic
- Similar topics
- Gels