, how many days/month required from pollination/fruit setting to harvesting of passion fruit?

21 August 2019 1 4K Report

Dear Researcher,

I would like you to help me in the answer to the following questions about passion fruit; as I have tried on google but I have not found latest and authentic reference about these questions,

An average, how many days/month required from pollination/fruit setting to harvesting of passion fruit?

In how many stages we can classify the passion fruit from the Days After Fruiting (DAF) to Harvesting?

As we have classified into 10 stages depending on the pulp development, size and peel color, But, can you help me to classify as Days After Fruiting (DAF) into 10 stages.? For example, the 1st stage is 10-15 DAF, 2nd stage 15-20, 3rd 20-25 etc.

Yellow and purple required same time period from fruiting to harvesting? More or less?

How much is the total area and production under passion fruit in the world?

Which commercial varieties? and provinces are growing passion fruit in the world?

How many days, Yellow and purple passion fruit commercial post harvest shelf life? It's same or different (how many days).

8. What are the main post harvest causes of passion fruit? and how can control them?9- The main post harvest pathogenic causing agent of passion fruit?

Hafiz Muhammad Rizwan

Mark Cooper

Thanks a lot

Badges
Science topic

More Hafiz Muhammad Rizwan's questions See All

I'm interested to quantify Urea by HPLC method, reversed phase conditions are preferable. Is there a good method suited for urea?

I have to develop a method that can be good enough to run dozens of samples that include urea as the main compound. I prefer an HPLC method because of the convenience of running large numbers of...

01 February 2021 1,888 4 View

How to convert ng/ul of DNA concentration to pmol/ul ?

Dear researcher, After amplifying my target gene (1900bp) into the required cDNA by PCR,>cut specific gel bands and purify the gel and the concentration was 30ng/ul. Next, performed A-Tailing...

21 January 2021 2,671 3 View

Can use Unigenes from RNA sequences for overexpression studies (transformation) without requiring a specific plant genome?

Dear researchers: If the plant genome has not been released yet, can Unigenes from RNA sequences be used after BLAST and confirmed with known Arabidopsis genes for function/overexpression...

20 January 2021 5,557 2 View

What is the reason of weight gain in TGA curve of a HDPE polymer sample ?

HDPE samples were aged at higher temperatures in the presence of water and CO2 than the TGA test was performed in Nitrogen? Weight gain is seen in the curve? What could be the possible reason for...

16 January 2021 5,644 2 View

Can BLAST/ search by using known Domain in Transcriptome/Genome data for a gene family?

Dear Researchers, I have Transcriptome/Genome data and want to list all the member of a KCS/CER gene family whose Domain AP2/ERF, FAE1_CUT1, according to the Arabidopsis database, so is there...

15 January 2021 2,293 3 View

Is it necessary to measure the concentration of PCR/Gel purified product for A-tailing and TA cloning?

Dear Researchers, While working on plant gene transformation, so after cDNA + Gene Primer amplification, >the PCR/Gel were purified, so next for A-tailing and TA cloning is mandatory to...

12 January 2021 3,272 34 View

Can use the same vector for overexpression and transient expression?

Dear Researchers, I am using pCAMBIA1301/1302 vectors for overexpression study, so can use the same vectors for transient expression? or need to design another vector for transient expression;...

08 January 2021 7,975 2 View

Why negative controls also showing the specific bands of promotor and other regions (GUS, GFP etc.)?

Dear Researchers, I did a transformation of an empty vector (pCAMBIA1301/1302) into my passion fruit plants, for the optimization of the transformation protocol. After transformation; DNA...

06 January 2021 8,465 99 View

Can anybody help me out in TRNSYS about short term thermal energy storage used as buffer storage ..?

i am a beginner in trnsys and need help ... can anyone please guide me

20 December 2020 1,040 3 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

Is there a powerful system for the security of the systems distributed on IoT systems?

02 March 2021 3,858 10 View

Which is the best place in the world for the plant biotechnology research?

I am searching for a good place for the Post Doc,

02 March 2021 4,053 3 View

How Relativistic effects is one reason for lanthanide contraction?

The Lanthanide contraction which is the decrease in ionic radii of the elements in the lanthanide series from atomic number 57, lanthanum, to 71, lutetium, is due to poor shielding of the 4f...

01 March 2021 2,272 4 View

Which cell line should we use to perform biological dosimetry experiments?

We are preparing some experiments based on irradiating cells under different conditions in order to evaluate the effects in terms of DNA damage, genetic expression, etc. As our project is...

01 March 2021 3,355 3 View

Which bacteria are suitable for quorum sensing screening?

I want to find a quorum sensing inhibitor from plant extracts. Klebsiella pneumoniae, Moraxella catarrhalis, Staphylococcus aureus, and Streptococcus pneumoniae. I looked for these strains...

01 March 2021 7,675 3 View

Isolates of Hymenoscyphus fraxineus?

Dear Dr. Cai, my name is Simone Prospero and I work in the team of Phytopathology at the Swiss Federal Institute for Forest Snow and Landscape Research (WSL;...

01 March 2021 1,133 1 View

Where to find data on trees in tropical agroforestry?

Hi, I'm looking for data (mainly related to management: growth rate, canopy size, soil and climate preferences, etc.) about tropical trees used in tropical agroforestry. Have you ever heard about...

28 February 2021 7,356 8 View

How to remove fatty material from plant extract?

The resultant solid was partitioned three times with 250 ml of petroleum ether (40-60/c) to remove any fatty material and evaporated to dryness.

28 February 2021 9,464 2 View

How to eliminate Steady state error from Reinforcement learning genetic algorithm code?

The following code (see 1st 2 images attached) is used to produce PID controller values that are designed to control the system (G). The code finds the PID controller values (noted as k) by using...

28 February 2021 6,560 14 View

Good morning research fellows, Has anyone worked with senna alata plant extract on any kind of fish?

Literatures on the piscicidal effect of sennaa alata is scanty. if you have any related litrature either in the bark, leaves or roots used as treatment to any aquatic organism please kindly help...

28 February 2021 9,138 2 View