How can we interpret the phenomenon of agglomeration of alumina particles when mixed with pure aluminum powder via powder metallurgy?

17 June 2020 0 1K Report

W are preparing hybrid nano composite of graphene oxide and alumina added to aluminum powder by powder metallurgy, and at higher percentage of alumina, a considerable agglomeration of took place. A scientific interpretation of this phenomenon is needed

Badges
Science topic

More Galal Nassef's questions See All

What is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription (GAGTTCCAGGTCACTGTCACTGGCTCAGGGA) ?

GAGTTCCAGGTCACTGTCACTGGCTCAGGGA

02 August 2020 139 8 View

What is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription ?

what is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription ?

13 July 2020 7,601 3 View

How to do MPC tuning for 2nd order system ?

Hey, I'm working on basic MPC with Maciejowski book; I'm trying to tune 2nd order system (1/ (z^2 -1.4z+0.45)) for one coincidence points P=8 and for control horizon Hu or M= 1 , it is really...

23 May 2019 6,521 3 View

Can you give an example for a clinical Decision Support System in Dentistry with its link online?

I am searching for any type of clinical Support Systems or programs in Dentistry, present online or found as a free software online.

10 September 2014 9,137 3 View

After tongue cancer chemotherapy what is the best kind of nutrition?

Need suggestions for what the patient can eat. Please see details below.

23 February 2012 3,906 1 View

Why can't make aluminum nitride film successfully by use sputter?

We use reactive sputtering process to make aluminum nitride film, and want to make c-axis aluminum nitride film on a silicon substrate, but the crystal orientation cannot be seen with...

03 March 2021 7,975 3 View

What is the production process of CaFe ferroalloys?

I looking for ferro calcium production process

03 March 2021 1,755 4 View

12% ledeburitic cold work tool steel, etched for revealing retained austenite, any help for clarifying?

Hello everyone. Given microstructure image belongs to a 12% ledeburitic cold work tool steel (annealed and tempered). The sample was etched with picral (100 mL ethanol and 4 g picric acid). I...

02 March 2021 4,119 3 View

Why Austenite grains in steel show much more twinning than ferrite grains?

It is oftentimes said to be a distinctive metallographic trait that differentiates a fully austenitic and a fully felly ferritic steel without etching that might distinguish between two. Why...

02 March 2021 728 2 View

Can anyone share his experience regards Smoothing in origin?

I am working on TiO2 composite material and the results of XRD have a lot of small/junk peaks and while I apply a smooth filter in Origin then the other characteristics peaks disappear so anyone...

26 February 2021 8,183 3 View

How to generate AA6061 alloy or any aluminium alloy crystal in material studio?

I need to carry out molecular dynamics simulation on Aluminium alloy. For this i need the crystal structure that which could be further replicated to form a structure.

22 February 2021 1,410 1 View

XRPD Quantification - Building a calibration curve of drug excipient?

I am aiming to utilise XRPD to quantify a drug excipient within a drug product and have been having a little trouble building the calibration curve to allow for this quantification up until this...

10 February 2021 6,145 3 View

What could be the reason for XRD pattern starting from very high counts/intensity at 3 degree 2 theta?

I am working on XRD analysis of the clay minerals from the sea sediments. My XRD pattern shows very high counts at the start of the XRD pattern (3 degree 2 theta) which is very unusual. The counts...

31 January 2021 4,493 9 View

For Carbon-emission free steelmaking by electrolysis with nonoxidizable electrode in EAF, what would be electrode material?

While CCS can be employed along with a conventional Carbon-efficient EAF steelmaking process (especially from iron ore) or even Hydrogen or hydrocarbon can bee passed through central electrode,...

30 January 2021 3,378 1 View

What are the thermodynamic and kinetic similarities and differences among dendrite formation during solidification of metals, ceramics and polymers?

Basic dendrite formation of metallic alloys are explained by thermal and constitutional degree of supercooling and most-supercooled band of liquid somewhat ahead of solidification front that...

30 January 2021 8,450 2 View