How can I specify the value of colvar parameters in umbrella sampling with NAMD?

30 May 2024 0 9K Report

I am going to run an umbrella sampling to measure the PMF for passing ion from channel in NAMD software. I wanna know how can i find out the value of these parameters:

width, lowerboundary, upperboundary, lowerwallconstant, upperwallconstant and force constant

Badges
Science topic

Similar topics
Chemistry
Carbon

More Fateme Akhondfeyz's questions See All

Is this a facetotecta nauplius?

This larva was captured using a plankton net in the Persian Gulf during the summer. I believe it may be a Facetotecta nauplius.

08 August 2024 3,746 4 View

How to use CINPE4 elements in ABAQUS for infinite boundaries?

Hi All, I have used infinite elements in Abaqus to absorb waves at the sides and bottom boundaries of the soil domain. but the boundary reflected wave can not be completely absorbed on the...

06 June 2024 448 4 View

How merge output files of simulation with NAMD?

I have been running steered molecular simulation with NAMD, but in the middle of my simulation it has stopped and i have restarted from specific steps which had stopped. Finally i have two parts...

19 May 2024 1,483 2 View

What is the reason of pattern of lithography in center of wafer are thicker in comparison of edges of the wafer?

Hello When we pattern a mask in a wafer, after exposure we noticed that the length of our patterns in the center of our wafer is thicker in copmarison with edges of it. What is the reason and...

22 April 2024 6,796 4 View

Why exon number change by zooming out in Genome Browser?

Why does the number of exons of PTPRQ change by zooming out in Genome Browser site? the NM number is: NM_001145026.2

21 April 2024 8,336 1 View

No matches result in silico PCR at Genome Browser webpage!?

I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009...

06 April 2024 3,951 4 View

What is the role of surface tuxture in anti gravel coatings?

Anti gravel or stone chip resistant coatings are often defined as textured coatings. Does the tuxtured surface play a role in the coating performance, especially in anti gravel properties?

22 March 2024 7,758 0 View

Have you ever run a steered molecular dynamic simulation with NAMD?

Hi everyone. Is there anybody here who have run a steered molecular dynamic simulation with NAMD and knows about the parameters which i have to write in my configuration file?

05 March 2024 7,935 1 View

How can the bitter taste from calcium chloride treatment in a protein product be minimized while maintaining the desired texture?

Greetings esteemed colleagues, I am currently working on my master's thesis, focusing on a protein product that requires the use of calcium chloride treatment in one of its stages to form calcium...

24 February 2024 1,806 2 View

How could i minimize and equilibrate system with available output files of CHARMM-GUI for NAMD?

I have downloaded output files of CHARMM-GUI for NAMD which i had made membrane-protein complex with CHARMM-GUI and now i don't know what should i do with these files before running simulation...

13 February 2024 4,182 0 View

Are there instances where molecules with larger molecular weights exhibit greater mobility than those with smaller molecular weights?

Hi, I know that low molecular weight (MW) molecules generally tend to have higher mobility, while high molecular weight molecules tend to have lower mobility. However, in my experimental...

06 August 2024 1,495 2 View

For an in-vitro drug release study, what molecular weight cut-off (MWCO) dialysis bag is required for a 117 kDa protein?

kindly reply me. Thanking you in advance.

05 August 2024 7,727 4 View

How to Add Missing Water Molecules in Protein-Membrane Simulations?

I have protein-membrane simulations (PDB, PSF, DCD) and have noticed that water molecules near the protein are not visible in the simulations. How can I fix this issue? Is there a way to place the...

04 August 2024 1,200 2 View

How to start a Molecular Dynamics Simulation?

Is it possible to conduct a molecular dynamics simulation to see the effects of a specific carbohydrate on the structure of lipids (e.g., micelle structure)? I am a beginner in this field and plan...

03 August 2024 3,371 3 View

Which will be the best software for the Hydration shell analysis with molecular dynamics?

I am using a windows system, what software I should use for hydration shell analysis with molecular dynamics?

02 August 2024 3,143 4 View

Can anyone provide me with molecular docking softwares/ websites?

Molecular docking software/ websites?

02 August 2024 8,704 7 View

Can we patent a process flow diagram developed using a process simulator but no actual cases is carried out?

Can we patent a process flow diagram developed using a process simulator but no actual cases is carried out? For example consider a process for certain product manufacture where a new process flow...

31 July 2024 781 1 View

CAD File of human's & rat's respiratory airways ?

Dear all, I am working on particle deposition in human's & rat's respiratory airways using CFD and I am looking for the 3D CAD file for my simulations (STEP or IGES format). If somone has such...

29 July 2024 1,092 2 View

How to restart MD without using checkpint file in GROMACS?

Dear All Gromacs User I would like to restart MD without using checkpint .cpt files? I heard there is a way for acheiveing this. Any input and sugegstions are most welcome. Thanking You Budheswar

29 July 2024 3,084 8 View

AutoGrid and Autodock 4.2.6 window opens for 1 second then closes and there is no output files?

Good day, I am a student trying to work on Autodock for a project regarding Ligand-DNA interaction so i am quite new to molecular docking. i have followed tutorials and did all the steps...

28 July 2024 2,136 4 View