I run a qPCR (Taqman probe) to detect shiga-toxin gene (stx1) with rotar gene Q (qiagen) thermal cycler.
My primer & probe are -
F - 5'-TTTGTYACTGTSACAGCWGAAGCYTTACG-3'
Base - 29, GC - 44.8%, Tm - 60.6 C
R - 5'-CCCCAGTTCARWGTRAGRTCMACRTC-3'
Base - 26, GC - 51.9%, Tm - 60.0 C
Probe - 5'/56-FAM/CTGGATGATCTCAGTGGGCGTTCTTATGTAA/3bhq_1/-3'
Base - 31, GC - 45.2%, Tm - 60.9 C
Master Mix - KABA PROBE FAST qPCR MASTER MIX (2X) Kit
Reaction volume 20 µL
Primer (F) – 0.6 µL
Primer (R) – 0.6 µL
Probe – 0.25 µL
Master mix – 10 µL
DNA template – 3 µL (20.23 ng/µL)
DW – 5.55 µL (negative control – 6.55 µL )
PCR condition
Enzyme activation – 95˚C for 5 minutes
40 cycles – 95˚C for 3 seconds & 60˚C for 30 seconds
hi,
did you check the raw data? This can be due to a noisy baseline or the algorithms used. Would first check raw data and then check the different settings, e.g. with and without slope correct
Have you run a checkerboard for Mg etc as well as Primer/Probe concentrations? Could be a mastermix issue
It seems to me that the problem may be that primers and probe are at the same temperature, while the following is recommended: The primer melting temperature (Tm) should be around 58-60 oC, and TaqMan® probe Tm should be 10 oC higher than the Primer Tm. The Tm of both the primers should be equal.
Assuming that everything is in order with the primers and pro
be, then the problem may lie in the thermal cycling mode. 3 sec seems too small.
In the original article with these primers, I found other amplification conditions used were the following: 50°C for 2 min, 95°C for 10 min, and then 45 consecutive cycles of first 15 s at 95°C and then 1 min either at 55°C (wzx gene for serogroup O103 detection) or at 60°C (all other targets). Article Application of the Modular Approach to an In-House Validatio...
And
The amplification conditions were 95 8C for 10 min, followed by 40 cycles at 95 8C for 10 s with a temperature transition rate of 20 8C/s, 55 8C for 5 s with a temperature transition rate of 10 8C/s, 72 8C for 15 s with a temperature transition rate of 0.4 8C/s and a cooling step at 40 8C for 30 s. The generation of fluorescence for each sample was monitored at the end of the elongation steps in the channel F1 (530nm) for fluorescein-labeled probe corresponding to stx1. https://www.sciencedirect.com/science/article/abs/pii/S089085080300121X?via%3Dihub
You are using the same e. coli, as in the article?
Have you tried to analyze the resulting PCR product in an agarose gel?
I also advise you to check in which channel you are measuring fluorescence. Htet Lin Oo
- Badges
- Science topic
- Similar topics
- Chemistry
- Biochemistry
- Biochemical Techniques
- Blotting Techniques
- Immunoblotting
- Dyes