How can I get good PCR protocol for the exon4 of LDLR gene?
This link maybe useful
Single step PCR for the identification of Low Density Lipopr...
You can find suitable PCR protocols here:
http://www.jlr.org/content/44/10/1850.full.pdf
https://edoc.hu-berlin.de/bitstream/handle/18452/12424/asami.pdf?sequence=1
Exon 4 primers:
Forward Primer: TGGTCTCGGCCATCCATCCCTGCAG
Reverse Primer: ACGCCCCGCCCCCACCCTGCCCCGC
Thank you for this information on this topic
i am planning to do ELISA for AB quantification in an Alzheimer related project. the sample is cell culture (not animal samples), since AB deposits in the extracellular environment should i use...
14 May 2024 5,244 3 View
Hello, dear researchers I hope you are doing well I have a high-dimensional tensor: 700*700*700 How can I train the proposed model with these dimensions? The predictive model is also a...
09 March 2024 6,557 0 View
Hello everyone I am trying to design an MTT experiment for an immortal adherent cell line with doubling time of 20 hours. The goal is to evaluate effects of certain growth factors and their...
13 February 2024 3,162 4 View
I have read some papers on MSC isolation from human adipose tissue. DMEM and DMEM/F12 medium have been used for expansion. I need to know which type of DMEM (low/high glucose) is preferred for MSC...
05 February 2024 9,290 6 View
Hello, dear researchers I hope you are well Is there a tool that gives 3D coordinates for each amino acid? The protein sequence is in FASTA format An example sequence...
31 January 2024 1,375 7 View
Hello, dear researchers I hope you are well Please introduce a reference that shows the role of the GAN network as a sample producer or sample generator It means that the GAN network balances a...
29 January 2024 9,977 0 View
HELLO DEAR reseacher what is different between Precision , reconition rate, and accuracy ? Plese introduce your explaination based on proper references ? Thanks in advance
18 January 2024 2,135 3 View
DEAR Reaseher I have question in machine learning How to get pixel coordinates using distance coordinates in MATLAB or python?This means that we have distance coordinates such as...
15 October 2023 8,904 7 View
Hello dear researchers There is a data set with a blessing rate of 1 to 17 means that the number of negative classes is 17 times the number of positive classes To address this problem, sampling...
18 September 2023 5,036 3 View
I need to dissolve sap, what is the proper solvent?
20 August 2023 7,831 1 View
I'm cloning a fragment of 3200 nts into plasmid. The cloning was successful, however, 02 amino acids were mutated. Now I want to fix these 02 aa by site-directed mutagenesis technique using...
08 August 2024 4,645 2 View
After performing symmetric PCR, PCR purification was performed. Afterwards, asymmetric PCR was performed using the PCR purification product as a template, but no ssDNA band was confirmed in the...
08 August 2024 1,668 3 View
i have sorted anti-NP specific plasma cells from bone marrow of C57BL/6 mice at certain times after immunization with variable counts and isolated total RNA using TRIZOL method for RT-PCR using...
05 August 2024 8,835 1 View
A Markov-like Model for Patient Progression" Markov Chain Monte Carlo (MCMC) Markov Chain Monte Carlo (MCMC) is a powerful computational technique used to draw samples from a probability...
05 August 2024 10,079 0 View
I want to introduce a point mutation (change in one nucleotide) into my gene of interest (DNA binding domain) I have designed primers as recommended on the Data sheet of the kit : -Both primers...
05 August 2024 9,059 3 View
I am performing ligation of the plasmid and a target gene. The steps I have taken are: 1. Double digestion of the plasmid and target gene 2. Ligation of the plasmid with the target gene 3....
05 August 2024 2,570 3 View
I am having an issue with my gel image where my PCR product is not appearing very bright on the gel. When I perform gel extraction, the A260/280 purity value is very low. I used the Qiagen gel...
05 August 2024 9,798 3 View
Read the journal article by Douglas M. Lambert, “The Eight Essential Supply Chain Management Processes,” Supply Chain Management Review, Vol. 8, No. 6 (2004), pp. 18-26
04 August 2024 9,919 4 View
How does the atmosphere affect the flow of matter and energy on Earth and flow of energy in the biosphere related to the flow of food through a food chain?
02 August 2024 9,644 0 View
I have been attempting to extract DNA from Bacterial, Fungal and Yeast banked samples (>1e7 cells) using Prepman Ultra reagent and I seem to be struggling to obtain a sequence. Although the...
01 August 2024 2,079 0 View