How can I get good PCR protocol for the exon4 of LDLR gene?
This link maybe useful
Single step PCR for the identification of Low Density Lipopr...
You can find suitable PCR protocols here:
http://www.jlr.org/content/44/10/1850.full.pdf
https://edoc.hu-berlin.de/bitstream/handle/18452/12424/asami.pdf?sequence=1
Exon 4 primers:
Forward Primer: TGGTCTCGGCCATCCATCCCTGCAG
Reverse Primer: ACGCCCCGCCCCCACCCTGCCCCGC
Thank you for this information on this topic
Hi Dear researchers In ensemble-based architectural design Which algorithms are more useful for classification? What is the difference between parallel and ensemble architecture? Thanks I am...
08 February 2021 2,727 5 View
I designed a plasmonic slot waveguide using gold on top of the 2 micron oxide layer and below the oxide layer, I used silicon as substrate. the idea is to optimize the waveguide dimensions (slot...
01 November 2020 4,400 3 View
Hi, I designed the cross section of the plasmonic slot waveguide using wave optics module in comsol. I used mode analysis method and now I am going to calculate the group velocity of my structure....
22 September 2020 2,660 3 View
I want to know how the modes are excited when we use mode analysis study in Comsol? when we use boundary mode analysis in Comsol, the modes excited using ports we create. what about the excitation...
23 May 2020 529 9 View
I designed a plasmonics slot waveguide using Comsol but I want to know the steps of optimization of evanescent field ratio(EFR) versus slot height and width. The problem is with the increase of...
18 March 2020 3,222 6 View
can any one know about the relationship between the effective mode index of a mode and its attenuation coefficient. I want to calculate the propagation length of plasmonic slot waveguide I...
08 March 2020 7,159 6 View
I am simulating slot waveguide using mode analysis in wave optics module performed in COMSOL multiphysics. I got the results and also the effective mode index for our mode. however, when I...
26 February 2020 8,434 4 View
Hi Everyone I'm working on Targeted drug delivery using Aptamers. I synthesized PLA-PEG-COOH and afterwards I tryed to link Aptamer via linkage of -NH2 in Aptamer and -COOH in PEG. first I...
14 January 2020 9,140 1 View
Currently, the blocks in the model are look up tables with two inputs (Temperature , SoC) (the link is attached). I want to modify the resistors to have three inputs (T, SoC, and Cycles). But, I...
12 August 2019 8,259 1 View
For instance, the way you present the persona.What factors affect your "voice" ?
03 September 2018 8,969 4 View
Hello, We would like to increase the yield of our PCR product. We are running a series of PCR reactions that is targeting ~1.1kb sequence. We begin each reaction with ~400pg of template DNA...
02 March 2021 4,029 3 View
Hi, I am planning to apply for the PhD degree in the Supply Chain Mgt. with specific area of "Cold Storage warehouses" during Pandemics and wars. Where lock downs and shut downs are frequent....
02 March 2021 285 2 View
So, I have been trying to run a pACYC PCR which will be used later on for a Gibson Assembly. However the PCR is not working. I have already tried gradient PCR and changing extension time; however...
02 March 2021 1,146 2 View
I am going to have 3 different probes in my qPCR work that I am going to do. But I realized that the machine we have in the lab is a Rotor-Gene Q 2plex HRM Platform, saying it has green, yellow,...
01 March 2021 8,544 1 View
To dear Researchers, I was analyzing a series of concentration for estimation of Real-Time PCR efficiency. The concentration was 1:10. I used MS-excel to evaluate Slope. The result of slope was -8...
01 March 2021 8,683 4 View
Does anyone have the experience of using Taq Man probes in the QIAGEN Rotar- Gene qPCR machine?
01 March 2021 5,311 1 View
Dear All, mirna primer showing some problem in the melting curve? any idea why? As attached is the melting curve. The forward sequence is obtained from miRBase and reverse primer is universal.
28 February 2021 5,008 4 View
I performed site directed mutagenesis, transformation, and then I sent out plasmids for Sanger sequencing and found out that there is extension of DNA just before the stop codon. I am not sure...
27 February 2021 547 3 View
Hi, my question is about the heating of thermal cycler machines and I hope some of you had experienced a similar thing previously. There are two thermal cycler machines in the lab(BioRad) and for...
26 February 2021 4,777 4 View
Hi I am a bit confused. They are asking me to find out the volume of DNA required in ul (a total of 30-100 ng for genomic DNA) from the DNA concentration in the nanodrop reading which was 404.8...
26 February 2021 5,029 2 View