How can I calculate adsorption of dyes on nanoparticles using ADF software?

More Kashmala Nadeem's questions See All

How can I find the cracked version of ENVI-met software?

Envi-met software

07 August 2024 8,188 1 View

Entropy measure and QSPR modeling in Graph Theor. How to construct the table for lengthy equation?

The entropy measured of molecular graphs plays a crucial rule. The network structures in some cases are very lengthy calculations to handle. Some author avoid to construct table where as most...

30 July 2024 3,126 0 View

Critique Calculaltion in Topological Indices and QSPR Modeling?

The first step is to analyze a 2D molecular graph and implement partitioning techniques to calculate the topological indices. Secondly impose statically tools to generate QSPR model, may or may...

24 July 2024 9,644 1 View

What strategy should be adopted to calculate topological indices efficiently?

Most of the time it is observed that in many manuscripts there are several typo error of topological calculation errors of calculation and partition of edges what ever the type of partitioning it...

22 July 2024 811 0 View

Nicotiana benthamiana seeds sterilization methods for tissue culturing?

I have been trying to grow Nicotiana benthamiana via tissue culture. I used ethanol and sodium hypochlorite with different concentrations and time duration for seeds sterilization and lastly...

18 June 2024 1,756 3 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

QSPR model is not fit for or it does not deliberate best answers. How we can improve it?

The QSPR analysis some time fails to produce relevant answer. what we should do to get improve results.

29 August 2023 7,764 2 View

What the difference exists between the QSPR analysis by using 2D and 3D model of drugs structures?

Where as some authors use 2d model and other use 3d model. How we can distinguish what the difference. Are the results same or different?

27 August 2023 552 2 View

How to establish a Mathematical Model on "Transfer of heat in human body organs"?

I'm looking for a mathematical model for transfer of heat in human body organs especially (eye, heart, brain and lungs). How is the behavior of heat transfer at normal and extreme levels

12 July 2023 4,888 2 View

Absorption coefficient of methane?

Hello, Can anyone provide me with the absorption coefficient of methane gas at 7.7 um? Any reference?

06 August 2024 980 5 View

Could dyes amplify the spectrum of light to a specific wavelength?

I am interested to know the behavior of dyes toward light. Specifically, Blue dyes re-emit the spectrum, especially from the green zone (known as principal in LED lamps, and blue dyes are known...

05 August 2024 3,290 1 View

In the presence of VERY high concentration (1000 ppm) of silicon, the adsorption isotherms of arsenic are showing anomalous trends, why so?

I conducted an adsorption experiment of arsenic on soil in the presence of different doses of silicon as competing ions to see the effect of silicon on arsenic adsorption and desorption. I took 5...

03 August 2024 6,500 3 View

How to calculate pseudo order kinetics?

I know the rate law. But for my photo-catalytic experiments, first 90min is adsorption (dark) and next 150min is under UV light (total 240min). How to remove the adsorption part for calculation?...

21 July 2024 8,807 6 View

Waht is the effect of isoelectric point on MB dye photodegradation by ZnO nanoparticles?

Recently I have submitted an article regarding MB dye degradation by ZnO nanoparticle. I received a suggestion to include the discussion on the effect of pH. I want to know what is the impact of...

19 July 2024 4,868 1 View

Please, from the computational calculations of an organic compounds using Gaussian program?

Using DFT/B3LYP/6-311++G

17 July 2024 7,720 1 View

How to decrease hydrophobicity of Ni-foam?

As, my studies are related to water adsorption, the substrates should be hydrophilic in nature. Ni-foam being hydrophobic in nature, the results are not as expected as in literature. Hence i...

14 July 2024 8,847 4 View

Help me to identify these fungal slides?

These fungal slides are isolated from cultured Bread mold on PDA media and smear is treated with Lacto phenol Blue dye ..

13 July 2024 9,701 1 View

Surface adsorption with the help of iron and UV/H2O2 is innovative?

1.The topic I am going to research is "Advanced Gray Wastewater Treatment Output from the Biological Process by Iron-assisted surface adsorption and UV/H2O2". I think this method has been used a...

08 July 2024 9,464 1 View

How can magnetic Biochar remove dye pollutants, is this technology beneficial?

The harmful Dye pollution from industrial processes such as textile generated how to remove with magnetic biochar ?

07 July 2024 8,118 1 View