Hi. Everybody.. Could anybody has clue? How should I design the scramble sgRNA as a negative control for CRISPR Cas KO interpretation?

More Nagendra Verma's questions See All

Does anyone use antinuclear antibody (ANA) and anti-Phospholipid antibody ELISA kit for Non Human Primate serum samples?

I am looking for anti-nuclear antibody (ANA) and anti-Phospholipid antibody ELISA kit for Non Human Primate serum samples. Any suggestions highly appreciated. Thank you.

28 February 2021 6,512 3 View

How to estimate the extent to which the FE domain should be meshed with explicit elements in Explicit-Implicit Time integration procedure?

I am developing a MATLAB code for shock problem and want to divide the FE domain into explicit and implicit elements (region of domain at vicinity to shock is meshed into explicit elements and...

15 January 2021 1,968 2 View

How to adjust a covariate in meta-analysis?

Suppose I am meta-analyzing proportions using their logit transformations. We did a meta-regression of the covariates age, gender, and disease severity score in studies and get respective beta...

11 January 2021 9,409 4 View

Is it possible that first waiting time decreases and then after a certain point waiting time start increasing?

The sevice rate is fixed and the arrival rate is changing. As I am plotting the graph of arrival rate with respect to waiting time in queue.

22 December 2020 2,455 1 View

Which gas is used for Bunsen burner in ASTM D6413 Vertical Flame Test?

I'm trying to make a Vertical Flame Test apparatus for flammability test of PVC based leather. I'm not sure about the type of gas which is to be used for generating the flame using bunsen burner.

09 November 2020 1,808 1 View

How does culture impact our ability to learn?

I am working this area, please inform some web resource that will help me.

14 October 2020 9,107 7 View

How to produce ROC/AUC curve using various groundwater vulnerability method for comparative analysis?

ROC/AUC Vulnerability Groundwater Machine learning

11 October 2020 9,186 3 View

When to add H2DCFDA dye before or after treatment and why?

When to add ROS generation binding dye H2DCFDA, before or after treatment and why?

07 September 2020 4,962 3 View

Poisson's ratio of nano hydroxyapatite?

I have powder of nano-hydroxyapatite with average particle size of 100 nm. I want to find the poisson's ratio of nano-hydroxyapatite.

30 June 2020 7,704 5 View

Why my steel is not showing the RF values when being loaded in modelling of CFST on abaqus ?

I did the frequency analysis(selected buckle in linear perbutation ) , found the eigen value and gave the same as a load while again performing the analysis , this time selected general RICKS . I...

27 April 2020 6,536 13 View

Gel electrophoresis result for total RNA samples, 1.5 Agarose gel was used, How to improve the integrity of RNA?

Gel electrophoresis, RNA degradation, RNA extraction from fresh tissue

02 March 2021 5,433 5 View

Is it possible for two human neuronal cell lines to have different gene sequence for the same protein?

I am looking at the ATP1A2 (Sodium/Potassium ATPase alpha subunit 2) in two human neuronal cell lines. Expression levels of this protein seems to be almost equal when detected by one antibody....

01 March 2021 3,607 3 View

Problem with shRNA transfection. Why are only two plates getting contaminated instead of all?

I transfected my LNCaP-WT cells with 3 shRNA plus their NTC two weeks ago and split two puromycin selected cell plates on Friday last week(Feb 26). I checked for GFP in the cells, and they all...

28 February 2021 4,949 3 View

Genome-wide gene identification protocol ?

Is there any book chapter/book, webpage or research article available to understand genome-wide gene identification?

28 February 2021 8,095 1 View

Any specific pipeline or parameter to analyse total transcriptomics study of brain tissue samples?

I have two groups of brain samples, control and treated for example. It was total RNA nova seq sequencing. I tried all the available pipeline like: star+rsem+deseq2, Hista+stringtie+cuffdiff,...

27 February 2021 356 6 View

Why is the efficiency of viral mRNA electroporation in PBMC low?

Hello, I have been struggling with the electroporation of PBMC with HIV-I mRNA. Although the quality of the RNA generated is good, and the handling of the cells in meticulous, the frequency of...

27 February 2021 9,233 3 View

What is the best concentration of cDNA to be used for qPCR?

I have synthesised cDNA from 500ng/ul of RNA. The concentration of the cDNA Is about 5000ng/ul. Should I dilute my cDNA or just use it as it is for my qPCR? I usually use 2ul of cDNA for a 20ul...

24 February 2021 8,618 3 View

Recommendations on homogenizers for RNA isolation?

I will be performing RNA isolation with frozen lung biopsy samples and am in the market for a tissue homogenizer. I am wanting a homogenizer that will fit in a 1.5ml tube. I was looking at the...

24 February 2021 3,623 3 View

RNA-seq DEGs downstream analysis and reporting in literature?

I used EdgeR to get the list of DEGs (differentially expressed genes) from my liver RNA-seq experiment. I have done the gene overrepresentation and GSEA based pathway analysis. I am currently...

23 February 2021 8,969 1 View

Is it efficient to do liquid biopsy to investigate the gene expressions of the tumor?

To do liquid biopsy and look for specific gene expressions there are so many published papers. Thera are different protocols and procedures used to isolate circulating cell free RNA or mRNA from...

23 February 2021 7,326 5 View

Ankit Jaiswal

Hello, Nagendra please go thru the link below it might help.

http://www.origene.com/support/FAQs/getFAQ.aspx?prod=CRISPR/CAS9

Here is the scrambled sequence from OriGene

5’ GCACTACCAGAGCTAACTCA 3’

Yang Yu

Designing a scrambled sgRNA (single-guide RNA) as a negative control for CRISPR-Cas9 knockout (KO) experiments is an important step to validate the specificity of your CRISPR experiment. The scrambled sgRNA should be designed to not target any genomic sequence in the organism you are studying, ensuring that it serves as an effective negative control. Here are some guidelines for designing a scrambled sgRNA:

Sequence Randomization: The scrambled sgRNA should have a similar nucleotide composition to your target sgRNA but arranged in a random order. This helps in maintaining the same GC content and overall structure but without the specificity for your target gene.

Avoid Off-Targets: Ensure that the scrambled sequence does not have significant homology to any other genomic sequences in the organism. This can be done by using bioinformatics tools to check the sequence against the genome for potential off-target effects.

Maintain sgRNA Backbone: Keep the sgRNA scaffold intact. Only the targeting (spacer) region of the sgRNA should be scrambled. The scaffold is crucial for the sgRNA to bind to the Cas9 protein and should remain unchanged.

Use Bioinformatics Tools: Employ CRISPR design tools that can help you design sgRNAs and evaluate their potential off-targets. Some of these tools also have the functionality to create scrambled sequences.

Functional Conservation: If possible, design the scrambled sgRNA to have a similar level of functionality (like efficiency of Cas9 binding) as your specific sgRNA. This can be achieved by maintaining a similar GC content and avoiding secondary structures that might hinder the binding.

Testing Multiple Controls: It's often beneficial to design and test multiple scrambled sgRNAs as negative controls to ensure robustness in your control data.

Blast Search: Once you have a scrambled sequence, use a BLAST search against the genome of your organism to confirm that it does not have significant homology to any genomic region.

Remember, the key purpose of the scrambled sgRNA is to demonstrate that the effects observed in your CRISPR experiments are due to the specific targeting of your gene of interest and not due to off-target effects or general perturbations caused by the introduction of the CRISPR-Cas9 system.

l With this protocol list, we might find more ways to solve this problem.