my oligo forward: 5`->3`:CACCGCTAGACACGGAATCATGCCG
reverse 5`->3`:AAACCGGCATGATTCCGTGTCTAGC
I done all things stickily followed the zhanglab protocol-Target Guide Sequence Cloning Protocol, digest vector run gel and get two band ,the small one is about 2kb，Gel purify the large one at a concentration 39.4ng/ul total 30ul of 5ug vector，260/280=1.92，260/230=1.42，phosphorylate anneal my oligos ,dilute annealed oligos 1:200, ligation reaction as the protocol indicated, transform 5ul of ligation production into 50ul stbl3 cell, grow in 30℃ for 20hours,each plate have about 15 colonies , then pick 8 of them for sanger sequence, none of them are correct,have anybody meet the same situation , which steps maybe wrong? any suggestion for me ,thankyou ! files are my sequence result ,lenticrispr v2 are the same as addgene show
Make sure you restriction enzyme is working properly. You can try to transform your bacteria with your linearized plasmids (after gel purification and before ligation). In this case you should see no colonies on your agar plate.
You can repeat this after the ligation step without your annealed oligos added to the tube and theoretically you should see no or very few colonies again.
On the other hand, you can (must) perform a colony PCR before having any sequencing.
You can also redigest your cloned vectors.
Have more questions?
Thankyou Mohamad Pirouzfar, After a another try with my linear plasmid as a negative control, ligation plate have about 15 colonies and negative have no obvious visible colonies, I pick all of then for PCR colony ,only three of them have PCR production, then sequence ,result showed correctly insert into lenticrispr v2 vector. I think maybe the T4 DNA ligase is not as effectively as the manufactory instruction show, longer timefor ligation reaction may better.
Most likely your problem is with the T4. Optimizing a ligation reaction with a certain ligation set (the enzyme, the backbone, the insert and the buffers) is essential. Try various incubation times (1 hour to overnight) in different temperatures (4, 16 and RT).
Dear Mohamad, I get my sequence result this morning , I design six sgRNA and insert them into lenticrispr v2 respectively, even though I use the quickly T4 DNA ligase which ligate at room temperature for 5min, last time I just get 20% correct rate,but this time ligation at 22℃ for 2h the correct rate range from 25%-50%. I guess T4 ligase incubate time is a key factor, but maybe different sgRNA also vary the correct rate, fortunately I get all colonies I want, for those many times try, I pick 4 key factor :1, cut your vector thoroughly ,cut for a longer time maybe better ; 2, linear vector form gel extraction must to be a good quality I means have a proportion concentration and have good rate of 260/280=1.8-2.0 and 260/230=1.5-2.0(impurity vector may harm the T4 ligase efficiency );3.ligand your annealed oligos and linear vector for longer time maybe better;3,Choose competent cell with recombination gene (like Rec..)deletion or mutation to avoid recombination, in this protocol stbl3 is a good choice but top10 is not OK.
- Badges
- Science topic
- Similar topics
- Physical Sciences
- Materials Science
- Plating