12 December 2018 4 741 Report

my oligo forward: 5`->3`:CACCGCTAGACACGGAATCATGCCG

reverse 5`->3`:AAACCGGCATGATTCCGTGTCTAGC

I done all things stickily followed the zhanglab protocol-Target Guide Sequence Cloning Protocol, digest vector run gel and get two band ,the small one is about 2kb,Gel purify the large one at a concentration 39.4ng/ul total 30ul of 5ug vector,260/280=1.92,260/230=1.42,phosphorylate anneal my oligos ,dilute annealed oligos 1:200, ligation reaction as the protocol indicated, transform 5ul of ligation production into 50ul stbl3 cell, grow in 30℃ for 20hours,each plate have about 15 colonies , then pick 8 of them for sanger sequence, none of them are correct,have anybody meet the same situation , which steps maybe wrong? any suggestion for me ,thankyou ! files are my sequence result ,lenticrispr v2 are the same as addgene show

Similar questions and discussions