2 Questions 10 Answers 0 Followers
Questions related from Liao Liping
my oligo forward: 5`->3`:CACCGCTAGACACGGAATCATGCCG reverse 5`->3`:AAACCGGCATGATTCCGTGTCTAGC I done all things stickily followed the zhanglab protocol-Target Guide Sequence Cloning Protocol,...
12 December 2018 644 4 View
My protein have an Tm of 65℃ after elution with 200mM imidazole ,concentration is 0.2mg/ml,Then I concentrated protein by Millipore 30K ultrafiltration tube to an concentration to 2mg/ml, then I...
01 January 1970 1,310 8 View