Liao Liping

2 Questions 10 Answers 0 Followers

Questions related from Liao Liping

Have problems in insert sgRNA into lenticrispr v2 vector?

my oligo forward: 5`->3`:CACCGCTAGACACGGAATCATGCCG reverse 5`->3`:AAACCGGCATGATTCCGTGTCTAGC I done all things stickily followed the zhanglab protocol-Target Guide Sequence Cloning Protocol,...

12 December 2018 630 4 View

Did anyone have meet some protein which is denature and aggregrate when concentrated by ultrafiltration tube millipore

My protein have an Tm of 65℃ after elution with 200mM imidazole ，concentration is 0.2mg/ml,Then I concentrated protein by Millipore 30K ultrafiltration tube to an concentration to 2mg/ml, then I...

01 January 1970 1,291 8 View