I think mirZIP from systems bioscience is not inducible. I was thinking to make it inducible by cloning into knockout inducible RNAi system (Clontech). Just wondering how many bp mismatches are required in the opposite arm of hairpin? I'm not thinking about making 'sponge' at this moment though. Please suggest any relevant protocol if you have any.
miRNA-495 (target) AAACAAACATGGTGCACTTCTT
The Forward oligo codes the reverse complement of the target miRNA (lowercase), as well as the restiction site-like overhang. The reverse primer complements the F oligo and has its own overhang
antimiR495F GATCCCCaagaagtgcaccatgtttgtttcTTTTTA
antimiR495R AGCTTAAAAAgaaacaaacatggtgcacttcttGGG
Anneal these oligos and clone them into pSuper.
Hope it is clear
A.
You do not need mismatches to target a miRNA, they are called antimiRs and what you do it to make a complementary of 21 nucleotides of your miRNA and clone them into a expression vector such as pSuper. I works fine for us. If you want the protocol how to clone it just let me know.
Design your oligos so there are restriction site-like overhangs.
Example:
GATCXXXXXXXXXXXXXXXXXXXXXX
XXXXXXXXXXXXXXXXXXXXXXTCGA
where GATC matches with the resulting overhang of Bgl II site in the vector and AGCT to Hind III. "XXX" is the 21 nts complementary to your target miRNA plus "TTTTT" as "terminal codon".
Annealing of oligos:
Resuspend DNA oligonucleotides at 0.25 nmoles/ul (water or TE). Oligonucleotides do not need to be phosphorylated or purified. Oligos are calculated to resuspend in 100mM (0.1 nmoles/ul), to calculate 0.25 nmoles/ul, divide the suggested volume for 2.5 = 0,25 nmoles/ul.
Annealing:
20ul oligo1 (=100nmoles/ml final concentration)
20ul oligo2 (=100nmoles/ml final concentration)
5ul water
5ul 10X annealing buffer (10X = 1M NaCl, 100mM Tris pH 7.4, autoclave)
50ul total (= 5 nmoles total of oligo)
OR if there is no enough volume for each oligo (20ul)
7.5 ul oligo1
7.5 ul oligo2
1.9 ul water
1.9 ul 10X annealing buffer
final volume 18.8
Heat >200 ml water to >95 degrees C in microwave, boil until big bubbles start being produced, immediately add oligos in floating rack (small tubes, use lockable caps), cover with aluminum foil and allow to cool to room temperature (usually two hours; overnight is fine). Alternately, a PCR machine can be used for annealing. Store the annealed template at –20. If you freeze them thaw them on ice!!!
Digest plasmid pSuper with Bgl II and HindIII at the same time for 2 hours (buffer B, promega). Run it in a 0.8% agarose gel for >30 mins, cut band from gel quickly (avoid to expose the vector to UV light as much as possible) and purify with the mini-columns.
ligation:
After annealed template has cooled down, dilute some of it 1:4000 (10 ul in 400 ul, 1:40; then 5 ul in 500 ul, 1:100) in 0.5X annealing buffer. Use 1-2µl of the 1:4000 dilution for ligation to 30-50ng of the Bgl II/HindIII restriction digested/gel purified pSuper vector in a 10ul volume. With concentrated ligase, this reaction can be done for 10-30 minutes at room temperature, with normal ligase place the tubes at 16C overnight.
I usually take 50 and 100 ng of digested plasmid (Bgl II/ HindIII) in different tubes 2x, in one I put 1 ul of annealed oligos and the other 2ul and ligate as above. Set up reactions to 10 ul including 1 ul of ligase buffer and 1 ul of ligase. Incubate overnight at 16oC or RT if using high concentration ligase.
Transform bacteria and screen for colonies next day
Good luck!
Adolfo
Thank you very much Dr. Adolfo. Your protocol looks nice. I have some queries regarding the design of the oligo. antimicroRNA will remain single stranded after being transcribed from vector, right? I don't need to add any loop like typical shRNA design? [Restriction site+antimicroRNA seq+(5-8 bp loop)+sequence complementary to antimicroRNA/original microRNA+termination signal+Restriction site] . I was little bit confused with this system since In this process, after transcription, ssRNA will form ds Hairpin structure. When it will be processed by Dicer, we'll get both antimicroRNA and original mature microRNA. To prevent the vector-generated mature microRNA to bind with mRNA, System Bioscience has made some changes in bases. But they didn't reveal their strategy of changing (http://www.systembio.com/downloads/miRZip_040809D.pdf). I was wondering is there any rule- like changing some bases in the seed region or something.
miRNA-495 (target) AAACAAACATGGTGCACTTCTT
The Forward oligo codes the reverse complement of the target miRNA (lowercase), as well as the restiction site-like overhang. The reverse primer complements the F oligo and has its own overhang
antimiR495F GATCCCCaagaagtgcaccatgtttgtttcTTTTTA
antimiR495R AGCTTAAAAAgaaacaaacatggtgcacttcttGGG
Anneal these oligos and clone them into pSuper.
Hope it is clear
A.
Hi Adolfo and Ruhul,
I would like to stably express an anti mir and found your posts suite my need very well.
There are 3 things that I would appreciate it if you could help elaborate:
1. The mature mir 495 and others are 22 nt, but you mentioned was 21. Is there 1 nt missed in your instruction?
2. You seemed to add c to the end of the complementary sequence in the F primer, aagaagtgcaccatgtttgtttc, would it be required or by mistake?
3. As we can know exactly the mature RNA made from the pSUPER vector (H1 promoter) after processing. Could I trouble to elaborate the mature RNA from this design of anti-mir?
Thank you and I hope to hear from you guys.
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Biology