hi all,
i'm having a problem to express my gene in E.Coli (BL21) of a nucleation peptide.
nowadays i'm suspecting that it might be because of a too short spacer in my vector: (the "map", and the beginning of the sequence follows)
'T7promoter-GG-lac.operator-G-RBS-TATAGCCATGGGC-my.gene."
" TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCGAAGGAGATATAGCCATGGGCAATGGTCGTGCTGGTTTAAAAATCCCGCGCTTCAGCGGCGTGCCGTATGGTAAAAGCGTTTTTATCAAAATGAAATACAA "
I have not found any evidence on the internet that this could be a problem, but i saw it it common to use a bigger spacer between the lac operator and the RBS.
(although i pretty sure that the lac.operator itself is a spacer good enough to be between the T7 promoter and the RBS....)
I be glad to here your opinion!
TNX,
Barak.
I think the translation starts from ATG located in your "spacer", 7 nt after rbs. Check the cloning region of pEt15b plasmid to see the translation start.
Hi Barak,
I had a similar problem recently, but my linker was too long between the RBS and the ATG and had too many GCs, which seem to be inhibitory.
I've used this tool:
https://salislab.net/software/reverse
It really helped me out to increase the translation rate.
You can simply insert your sequence and it calculates the approximate translation rate. Try to change your spacer length and sequence to see the influence on the translation rate.
Concerning your spacer between the T7p and the lac operator, I usually use around 6-7 bp. That always worked fine for me.
Good luck!
Best,
Filip
Thank u for your answers,
AIRAT- the original peptide is called "my.gene", and i added the "ATG" and a few nucleotide before in order to express it. sorry that i didn't mention that.
Filip- i've try "salislab" as u said. unfortunately, it didn't come with any results... (see attach). although the website looks really cool!
I think i will try to add Gblock- in order to add a 30 b.p. spacer, hope it would solve my problem.
Hi Barak,
did you try the "Predict: RBS Translation rates" link on the left-hand side?
There you need to copy your DNA sequence beginning from right after the third G of the T7-Promotor sequence until the end of your gene of interest or until the end of the T7-Terminator sequence.
Then you need to choose an E.Coli strain or what ever organism you use to express and then it should be able to predict your Translation Rates.
I've tried it with the short sequence that you've provided and it showed a very low translation rate. ~95 for your ATG (see attachment). Another ATG at position 91 shows a higher translation rate than your ATG.. But considering that the rates sometimes go up to multiple tenthousands that is still miniscule. You might want to also use the "Design: RBS Sequence" tool to optimise your sequences.
The 30 bp spacer that you mentioned might also be a good way to start optimizing.
Best of luck,
Filip
- Badges
- Science method
- Similar topics
- Biological Science
- Genetics
- Gene Expression
- Protein Expression