Does someone have an idea about how to start RF channel modeling in MATLAB to study the different parameters like multi path , rss at receiver?

More Alok Ranjan's questions See All

Is there any solar electric power plant having the concentrated photovoltaic modules?

The solar photovoltaic (PV) power plant uses commercial (non-concentrated) PV modules which are quite simple in design and reliable. They can work on fixed orientation and don't need the moving...

16 February 2021 3,796 9 View

Do we see connection between climate change and the transmission of coronavirus?

How likely are we to see the infectious disease spread as a result of climate change? How are the communities most at-risk, and how and why both COVID-19 and climate change harms them? Why is it...

09 February 2021 1,459 28 View

Tutorials for Flow boiling simulation using Fluent?

Hello, I am trying to observe pressure drop oscillations during boiling flows in Ansys Fluent. To do that I am trying to get more accustomed to modeling flow boiling in the software. So far I...

01 February 2021 6,446 2 View

Control in microstructure with growth inhibitor?

Dear researchers, I wish to understand the role of grain growth inhibitor in controlling the microstructure of the ceramic pellet. How it controls the growth? Also, I wish to know the grain...

15 January 2021 3,859 3 View

Does behavior (shy vs bold; rare vs abundant) and flock size (small vs large) of bird species play role in niche partitioning among sympatric species?

Sympatric birds may avoid competition via multiple strategies - by different activity period, different diet, different microhabitat etc. Has any one looked into behavior of sympatric birds as...

11 January 2021 9,600 1 View

How can we increase awareness about Covid 19 prevention in our city among the local population?

The general public must be made aware of the mode of transmission, presenting symptoms and the measures that can be undertaken to prevent the spread of infection. Few options- Media, Webinars...

03 January 2021 3,538 13 View

Buckling of Smart composite plates using FEM ( MATLAB code)?

Can anyone help me with the FEM coding for Buckling of composite plates using the FSDT or HSDT - Source or the helping material (textbook, research paper etc) - Geometric stiffness matrix...

03 January 2021 3,059 3 View

Optimization technique in ball mill?

Hi all, I wish to know about a common problem faced by most of the researchers who are dealing with ceramic materials that my ceramic powder is sticking with the balls after the operation. can...

02 December 2020 8,232 3 View

How to decolonize climate change research?

Who has the right to define what is climate change research should be? Who should define the climate change research topic, research questions, and research design? Who should own the climate...

29 November 2020 1,077 12 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

How to compare two groups with only two measurements?

Hiiiii everyone! I have an enquiry on statistical analysis. I was looking for many forum and it's still cannot solve my problem. I want to compare means of two groups of data but only with two...

03 March 2021 8,796 3 View

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10?

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10? Since, the growth curve from day 2 to 10 won't be like the "Logistic curve" it might not follow logistic...

03 March 2021 1,401 3 View

After a reference from Int J Body Compos Res, can any body help?

Hi, I am after the reference below, my library says it cannot obtain a copy either locally or internationally, any help appreciated! Chris Wang ZM, Heshka S, Wielopolski L, Pi-Sunyer FX, Pierson...

03 March 2021 6,193 1 View

What techniques can I use to determine the miscibility of polymer blends?

The term miscibility refers to the single-phase state in thermodynamics. I do not mean the compatibility of different components. To determine the miscibility I know several techniques such as...

03 March 2021 4,107 4 View

How to repeat an operation on an atom selection for multiple times in PyMol?

Hi, I am trying to construct a multi-layer fibril structure from a single layer in PyMol by translating the layer along the fibril axis. For now, I am able to use the Translate command in PyMol...

02 March 2021 4,569 4 View

What thickness need for ITO to use as conductive layer?

I want to do RF sputtering of ITO on glass substrate using magnetron sputtering. what thickness do i need to make it good conductive layer to use it for PSC. Moreover, whats about thickness of...

01 March 2021 395 3 View

Shall I skip the measurement model in SmartPLS?

Hello everyone, I had run a mediation model in SmartPLS using questionnaires that were already validated among my statistical population. A professor who edited my paper -though she is not...

01 March 2021 3,052 3 View

What is involved in morphological changes of SEM images of a substance?

In the sem analysis of CaCO3 nanaoparticles, the morphology images showed spherical shaped particles but the proposed morphology for these type of nanoparticles is trigonal. I prepared the...

01 March 2021 1,960 4 View

Joint behaviour in Abaqus is not captured well?

I am working on roof joint and trying to simulate the behaviour in Abaqus. I am successful in running the model but the final graph does not follow the experimental curve in the negative direction...

01 March 2021 6,661 3 View

Timeout error!! Processor in the loop (PIL) using STM32F4 Matlab 2018a?

Dear Researchers I am trying to perform a PIL simulation using STM32F4 Discovery board and comunication serial USB TO TTL. During simulation I receive the following timeout error: An error...

01 March 2021 2,327 1 View

V. E. Antsiperov

We done such investigation and publish results in paper of W. E. Antciperov, O. V. Evseev, G. K. Mansurov, A. V. Ponikar "Variability of received signal strength value in IEEE 802.15.4 (ZigBee) sensor nets and its influence on inaccuracy of mobile objects positioning" (http://jre.cplire.ru/jre/jun11/index_e.html). Unfortunatly it is published in russian. Nevertheless, there are a lot of pictures and formulas, so anyone can easilly reconstruct the content.

Alok Ranjan

Thank you for adding information Dear В. Е. Анциперов. However i would appreciate your effort if you could share that how to take initiative to do first part i.e. writing line of codes . And also, how one can use those formulas to further studies.

Zinal Patel

I do not know about RF channels but yes about the MATLAB. You can find your parameters from any IEEE papers. After that any help required in the coding part in MATLAB,let me know. I will try to help you in the code.