Bio-Rad's pre-validated Hist2h4 primer pair can be used to amplify both 18S and 28S rRNA.

Just a thought...Since 18S and 28S are connected on the same strand of DNA, you might try amplifying both separately and comparing the quantities between the two...might be similar, and each would act as the positive control for the other. OR perhaps a better method would be to use a forward 18S primer with a reverse 28S primer. Doing this would mean that you would amplify 18S>ITS1>5.8S>ITS2>28S. Which might be a large molecule, but if your 18S and 28S primers are placed to only amplify a smaller portion of 18S and 28S, then it might still work. I'm sure there are published/universal primers for both. 

Since there is no similarity between 18S and 28S sequences, I assume that what you want are RT-qPCR primers for 18S and RT-qPCR primers for 28S that will work on mice and humans.  

These primers: (5'-3')

18Sreg3F ctcaacacgggaaacctcac

18Sreg3R cgctccaccaactaagaacg

amplify 18S from human, mouse and rat and are suitable for analysis with fluorescent (Sybr-green etc.) qPCR.

Since 18S and 28S are processed by cleavage from the same primary transcript, it is unclear why you would want to measure them both--unless you think that some primary transcripts don't include both 18S and 28S segments or that one of them is preferentially degraded.

If you want primers for 28S that will work in mouse and human, there are long stretches of identity between these that can be used to design such primers--a file of the aligned sequences is attached.

Dear Rozer,

You can use the following link to get a sequence that has Both 18s 1nd 28s:

http://www.ncbi.nlm.nih.gov/nuccore/EU491501.1

Now, design a special primer pair for both. If you don't design do not hesitate to call me.

Best Regards,

M. J. N