Powder

• 1 year from date of receipt under proper storage conditions.

Solution

• 4 weeks at 4°C

• 3 months at –20°C

Most common way to degrade tet is either leaving it exposed to light or at room temperature.

If stored in dark at -20 degrees the solutions may work for a couple of months in my opinion. Since these are light sensitive, one should avoid long light exposures inbetween use.

What if they have been there for years?

Buy new if they have been there for years, and you are getting no response in your assay.

I too use doxycycline for same purpose. I generally make aliquiot of solution. I have been using it since 4 months and its still working :-)

go ahead with accelerated stability studies and then p'cological profile of course on animals

If they have been stored there for years try to figure out the shelf life of the drug at -20 degree clecius and that to storing a tetracycline derivative like doxycycline at thrawing conditions? I wont recommend any to carry out pharma chemistry nor pharmaceutics nor pharmacology research on it , unless and untill it satisfies all the assay tests and you wont need more than 1ml or even less solution to carry out %purity assay-Regards

Thank all guys! Well, I think the best way to test whether it's still working is to detect TetR protein. However, we don't have anti-TetR antibody at hand. Well, in my case, I just sent the inducible constructs for sequencing to rule out the construct error. At the same time, probably I am gonna buy new.

Buying new dox will most likely solve your problem. You could also run a RT-PCR for the TetR protein mRNA if you do not think it is being expressed. This would be a cheaper alternative to buying a TetR antibody. If you do this make sure you DNase treat your RNA and run a "no template" control in your RT-PCR. Because the TetR construct has no introns, your RT-PCR would amplify both cDNA (made from mRNA) and construct DNA. If you run the aforementioned controls, you will appreciate the amount of mRNA actually being expressed as opposed to just DNA construct in the cells.

Good luck either way,

~Adam

Thank you very much, Adam. Your suggestion is pretty awesome! I am gonna order the primers. :)

Hello Yang Liu! I have the same problem you had, Can you tell me the sequence of TetR  primers? Thank you very much!

Hi Laura,

Here is the sequence you may want for TetR primer:

GGCGAGTTTACGGGTTGTTA

5' end of tetracycline resistance gene, reverse primer

Please find this website: http://www.addgene.org/mol-bio-reference/sequencing-primers/

BTW, I just bought new Doxycycline to solve the problem...

Hi Yang,

Did you ever figure this out? I have the same question

better make fresh stock solution before your BIG experiment :D

Powder

• 1 year from date of receipt under proper storage conditions.

Solution

• 4 weeks at 4°C

• 3 months at –20°C

Dear Yang

If in doubt use new doxycycline or tetracycline. They are not that expensive. You don’t want to ruin your experiment using old ones.

Iqbal

Very useful info here:

Okerman, L., Van Hende, J. & De Zutter, L. Stability of frozen stock solutions of beta-lactam antibiotics, cephalosporins, tetracyclines and quinolones used in antibiotic residue screening and antibiotic susceptibility testing. Anal. Chim. Acta 586, 284–288 (2007).

thank you very much John and Laura, very helpful!

Best, Semjon