07 November 2023 0 4K Report

Hi,

Does anyone have worked on T. monococcum wheat?

Is there any browser like Gensys that includes passport data for T. moncoccum plants?

Tahnk you'

More Mayss Kassem's questions See All
What is the position of the International Court of Justice on the request of the Republic of South Africa regarding the crimes in Gaza?

What is the position of the International Court of Justice on the request of the Republic of South Africa regarding the crimes in Gaza?

24 June 2024 6,148 4 View

What is the legal status of stolen cultural antiquities sold at public auctions?

What is the legal status of stolen cultural antiquities sold at public auctions?

24 June 2024 3,683 3 View

How to select the optimum right tip (10 or 100 uL) for a Neon Transfection experiment?

Recently, we started using the Neon Transfection System in our lab. However, a very confusing concern popped up, and I would really appreciate your kind advice a lot. It is about the decision to...

21 February 2022 6,047 1 View

How could I calculate the threshold of volatile compound?

Is it a fixed value Or different with extraction and detection method of that compound

09 June 2021 1,410 1 View

Concerning the impact of the shift to distance instruction on EFL students' learning autonomy?

I wish to examine the impact of the shift to distance instruction on Saudi EFL college students' autonomous learning. Is it a sound methodology to compare the results of a current survey with...

08 April 2021 2,677 3 View

On what basis you choose the risk response strategy?

This response strategy tries to make sure that the risk happens, so you get the perceived benefit from the situation. Simple ways to do this could be to train the team to give them extra skills or...

30 November 2020 8,074 3 View

Is it better to isolate Exosomes from Serum or Plasma ???

I am currently planing to isolate exosomes/extracellular vesicles from diseased patients and control subjects using ExoQuick kit , then afterwards compare the expression of certain targets in...

14 November 2020 5,685 4 View

How to properly collect/store exosomes (isolated from conditioned culture media) for a later proteomic and/or metabolomic profiling?

I want to ask how to properly collect and store exosomes just after their isolation from conditioned culture media, for subsequent proteomic and/or metabolomic profiling ?? Should we make snap...

06 November 2020 5,470 3 View

Do Corona Virus Prevention Measures Promote Long-term Sustainable Development Goals in Improving Public Health and Environmental Management? How?

Sustainable development is the amalgamation of three aspects: economic, environmental, and political, illustrating that current standards of life should be maintained in order for future...

07 June 2020 6,100 0 View

How does the outbreak Covid 19 epidemic affect the productivity of the workforce in the construction sector?

The construction sector relies primarily on the workforce and direct contact between workers, supervisors and suppliers of building materials. What are the expectations for the level of labor...

26 May 2020 3,835 4 View

Similar questions and discussions
Hello Researchers, Can anyone guide me on estimating the Leaf Area Index (LAI) of wheat using only weather and soil parameters? Is it possible?

I need to estimate the LAI of a wheat crop using only weather and soil parameters. Can anyone please help me?

28 July 2024 4,886 2 View

Markers to distinguish individual cardiomyocytes?

I recently isolated mice cardiomyocytes and found some are not individual cells. I tried to stain the cells with Wheat Germ Agulutinin, it did not work. Does anyone have recommendations on the...

20 June 2024 3,225 2 View

How top dressing of nitrogenous fertilizers can be done in mulched wheat and rice crops and how should FYM/compost be applied in zero till wheat?

How top dressing of nitrogenous fertilizers can be done in mulched wheat and rice crops and how should FYM/compost be applied in zero till wheat?

02 June 2024 3,836 3 View

Gametocide for wheat?

We need to produce hybrid wheat seed for our experiment. Ca anyone tell me what's the best chemical agent for this purpose and where to buy the chemical agent? Thank you for your help.

27 May 2024 834 2 View

What are the essential data and calculations to be taken for the research that aims to increase soil Organic matter using mungbean as cover crop?

I am a researcher of Soil science department. 5 months ago I had planted wheat for my research. The research design was split plot design. it has 3 replications, each replication has 2 main plot...

05 May 2024 4,815 3 View

How can I extract DNA using Chelex100 from wheat common bunt?

Hi everyone, I'm trying to extract fungal DNA from wheat common bunt using chelex100 and I've tried several different protocols without any success. I've used different concentrations of chelex100...

29 April 2024 7,317 1 View

If the seeds didn't germinate well equally on every plot and i need data from 1m2 area only. can i sow seeds in 1m2 in gap filling for research?

I am a researcher of Soil science department. 5 months ago I had planted wheat for my research. The research design was split plot design. it has 3 replications, each replication has 2 main plot...

28 April 2024 7,432 5 View

Why exon number change by zooming out in Genome Browser?

Why does the number of exons of PTPRQ change by zooming out in Genome Browser site? the NM number is: NM_001145026.2

21 April 2024 8,336 1 View

What is the critical level of sulfur for wheat production in tropical soils?

I appreciate it if someone could get me references on the critical level of sulfur in tropical soils for wheat production.

15 April 2024 2,514 0 View

No matches result in silico PCR at Genome Browser webpage!?

I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009...

06 April 2024 3,951 4 View

Our partners will collect data and use cookies for ad personalization and measurement. Learn how we and our ad partner Google, collect and use data. Agree & close