20 November 2014 2 9K Report

I have a T7 transcribed RNA :

GGGACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGCCTGCAGGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTGG

I use a DNA: RNA chimera 2’Omethyl –CH3-Leader- (ACGCCCUGUUGACA)r-(CAAG)d to cleave RNA at a specific site.

I anneal the oligos at 90C for 3 minutes and leave them to cool at room temperature.  I then add the RNAse H buffer and RNAse (NEB) and incubate at 37C for an hour. I have tried incubations for 3 hours and more. 

Has anyone used RNA for this purpose?

More Anjali Pai's questions See All
Similar questions and discussions