I have a T7 transcribed RNA :
GGGACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGCCTGCAGGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTGG
I use a DNA: RNA chimera 2’Omethyl –CH3-Leader- (ACGCCCUGUUGACA)r-(CAAG)d to cleave RNA at a specific site.
I anneal the oligos at 90C for 3 minutes and leave them to cool at room temperature. I then add the RNAse H buffer and RNAse (NEB) and incubate at 37C for an hour. I have tried incubations for 3 hours and more.
Has anyone used RNA for this purpose?