Anjali Pai

10 Questions 16 Answers 0 Followers

Questions related from Anjali Pai

TSS data for wet lab researcher , easy bioinformatic analysis?

Dear coders and bioinfo enthusiasts, I wanted to elucidate the effect of nucleotide context on Cap proximal nucleotides in the 5' transcript leader. I wanted to look at existing TSS data from...

12 December 2017 2,253 0 View

What is the best way of filling in duplexes without amplification processes?

Hi, I annealed two primers at 95C for 10 min and cooled them to room temperature. They look like the figure attached below with a 20mer overlap. I want to fill in the duplexes but as I am using...

24 March 2015 3,123 6 View

What is the significance of +1 G in the T7 promoter?

Hi, I am looking at getting an equiprobable distribution of A,T, C and G on my RNA +1 using the t7 RNA production kit. The ideal promoter requirements is TAATACGACTCACTATAGGG. Does anyone have...

03 March 2015 3,155 3 View

What is the minimum intersection of template length required to anneal oligos? What is the best annealing buffer?

Hi, I am trying to anneal oligos 5'attacgccTAATACGACTCACTATAGNNNNNNNNNNACTAGCAACCT3' 3'TGATCGTTGGAGTTTGTCTGTGGTACCGGACGTCCCCGC5' Font in italics is the area of intersection.I have tried to PCR...

14 February 2015 4,454 6 View

Does anyone have a working protocol for RNAse H to cleave RNA at a specific site using an oligonucleotide target?

I have a T7 transcribed RNA : GGGACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGCCTGCAGGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTGG I use a DNA: RNA chimera 2’Omethyl –CH3-Leader-...

20 November 2014 9,208 2 View

I have an RNAse H treated sample for site specific clevage against the untreated. How can I seperate them?

As the RNAse H may not be 100% efficient at clevage, I want to seperate the cleaved from the uncleaved. I cannot seperate them on a gel due to their miniscule size difference of 15nt against a 1.9...

29 October 2014 1,298 5 View

Does anyone has an idea to test this reaction on a gel using fluorescent labelling?

I am planning to use RNAse H to get rid of the GGG from the T7 promoter post in vitro transcription

17 September 2014 7,784 2 View

Can anyone help with removing complex secondary structures?

I am trying to dephosphorylate RNA and ligate it after. My controls seem to work fine except for a long RNA which I suspect can't dephosphorylate probably due to secondary structures. I have tried...

06 August 2014 5,838 7 View

What is the best way to visualize longer lengths of RNA on gels (>3kb) ?

Would a 5% polyacrylamide urea gel work?

30 July 2014 508 2 View

Can anyone help with dephosphorylation of RNA using Rpph?

Hi, I am looking for a working protocol to dephosphorylate the 5'PPP into a 5'P using NEB Rpph (https://www.neb.com/products/m0356-rna-5-pyrophosphohydrolase-rpph). Do you denature RNA before...

13 July 2014 9,879 1 View