10 Questions 16 Answers 0 Followers
Questions related from Anjali Pai
Dear coders and bioinfo enthusiasts, I wanted to elucidate the effect of nucleotide context on Cap proximal nucleotides in the 5' transcript leader. I wanted to look at existing TSS data from...
12 December 2017 2,291 0 View
Hi, I annealed two primers at 95C for 10 min and cooled them to room temperature. They look like the figure attached below with a 20mer overlap. I want to fill in the duplexes but as I am using...
24 March 2015 3,174 6 View
Hi, I am looking at getting an equiprobable distribution of A,T, C and G on my RNA +1 using the t7 RNA production kit. The ideal promoter requirements is TAATACGACTCACTATAGGG. Does anyone have...
03 March 2015 3,223 3 View
Hi, I am trying to anneal oligos 5'attacgccTAATACGACTCACTATAGNNNNNNNNNNACTAGCAACCT3' 3'TGATCGTTGGAGTTTGTCTGTGGTACCGGACGTCCCCGC5' Font in italics is the area of intersection.I have tried to PCR...
14 February 2015 4,515 6 View
I have a T7 transcribed RNA : GGGACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGCCTGCAGGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTGG I use a DNA: RNA chimera 2’Omethyl –CH3-Leader-...
20 November 2014 9,247 2 View
As the RNAse H may not be 100% efficient at clevage, I want to seperate the cleaved from the uncleaved. I cannot seperate them on a gel due to their miniscule size difference of 15nt against a 1.9...
29 October 2014 1,389 5 View
I am planning to use RNAse H to get rid of the GGG from the T7 promoter post in vitro transcription
17 September 2014 7,840 2 View
I am trying to dephosphorylate RNA and ligate it after. My controls seem to work fine except for a long RNA which I suspect can't dephosphorylate probably due to secondary structures. I have tried...
06 August 2014 5,899 7 View
Would a 5% polyacrylamide urea gel work?
30 July 2014 555 2 View
Hi, I am looking for a working protocol to dephosphorylate the 5'PPP into a 5'P using NEB Rpph (https://www.neb.com/products/m0356-rna-5-pyrophosphohydrolase-rpph). Do you denature RNA before...
13 July 2014 9,923 1 View