Take a look here: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3195948/

Specially the section on TEV.

Thanks.

See also here: http://www.protean.cz/en/recombinant-protein/28/tev-protease

Thanks.

I think it may be too late but it is "GAAAACCTGTACTTCCAAGCG"

 Thanks. I appreciate it.

Even if it is a little bit old just a question Mahmoud Kamal Ahmadi. I just checked you sequence and I saw that the last aminoacid is not a glycin but an alanine. This is not affecting the activity of the TEV?

GGTGAGAATCTTTATTTTCAGGGC