Best Face Matching Algorithm?

16 April 2019 0 9K Report

I need some suggestion?

I need face matching algorithm which match human face (at age 5) and then we give same human face (at age 10).

Badges
Science topic

More Khawar Islam's questions See All

Has anyone applied Python in the field of textile engineering for data analysis, automation, or smart textiles?

I'm currently exploring the application of Python in textile engineering, specifically in areas like data analysis, process automation, and the development of smart textiles. I'm interested in...

10 August 2024 7,429 2 View

How to use ERP System in Global University ?

27 July 2024 8,229 0 View

How can I prepare the csv. dataset to find the flood triggaring factor using ANN?

here's a concise guide for preparing your CSV dataset in Excel to identify flood-triggering factors using an ANN: Clean and Format:Address missing values (fill with mean/median or remove if...

21 June 2024 7,941 0 View

How do integrate ECG, PCG, and clinical data to apply early fusion multimodal?

how do integrate ECG, PCG, and clinical data to apply early fusion multimodal?

10 June 2024 3,289 1 View

How can I make complex file of ligand (including flexible residues from protein) with protein Structure after AutodockFR docking?

I have performed the Molecular Docking using ADFR suite, I have obtained the files in _out.pdbqt format for ligand docked poses, upon inspection, both visually and reading the pdbqt files of...

08 June 2024 8,130 2 View

Could anyone suggest me which filter paper would be best for filtration process?

Dear Respected Scholars, I am working on detection of microplastic in prawn. Although, all the other parameters assessed smoothly but I have encounterd a problem during isolation of microplastics...

05 June 2024 2,469 0 View

How can I select the exact value in Flow Accumulation to identify the streams during Basin delineation?

In basin delineation and hydrological modeling, selecting the exact value in Flow Accumulation to identify streams is a critical step. The Flow Accumulation tool calculates the accumulated flow as...

30 May 2024 6,107 1 View

Are multi-level models appropriate for binary outcome variables for DHS datasets? If yes, what is the process?

30 May 2024 2,035 2 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

Challenges Faced by Freshers in IT Sector Recruitment?

i need to know what the key factors that the freshers are facing to get into the recruitment process, explain me clearly

31 July 2024 6,872 2 View

What are the most effective strategies for integrating sustainability in your expertise?

What challenges do you think businesses or entities face in implementing these strategies? Thanks

28 July 2024 2,125 14 View

I encountered a situation where the 16s PCR amplification worked perfectly with the DNA from the same sample, but using the same sample Don't working?

I isolated microbial DNA from marine water samples taken at various sites using the Qiagen Power Water DNA Isolation Kit, including a modified enzymatic lysis step. I encountered a situation where...

24 July 2024 9,688 0 View

I have two problems: 1) the enzyme is not immobilizing efficiently into the MOF material.. 2) the MOF itself has peak on 400nm by using p-NPA test.?

I am working on carbonic anhydrase immobilization into MOFs. I am facing problems with low enzyme loading.. The other issue is that when using p-NPA activity test to detect the activity of the...

20 July 2024 1,440 3 View

What is the best method to conserve the medicinal plant facing rapid decline in population ?

I have identified specific medicinal plant facing rapid decline in population due to population pressure, overutilization, unsustainable harvesting and limited distribution. What can be the best...

15 July 2024 6,599 2 View

Psychological Theories on the problems faced by people who are 'Bicultural'?

Theoretical framework

15 July 2024 1,508 1 View

Experience on Data for Master Thesis on Disposition Effect in Social Trading Platforms?

Dear Forum, My master thesis investigates the disposition effect—where traders sell winning shares too early and hold onto losing shares too long—on social trading platforms (STPs) like eToro,...

08 July 2024 187 0 View

What is the most important health question facing the world today?

What global health problem does your research address? Why does it demand an urgent solution?

05 July 2024 6,163 7 View

How can i claim my authorship?

I am facing a problem while uploading my article as it shows error that you can only upload an article when you are author of this publication although i am author but unable to upload my article

30 June 2024 910 1 View

How to solve this error in gromacs?

I am trying to run a md stimulation in gromacs for HDAC2 inhibitor and ligand. The protein is metalo protein, contain a Zn atom. Now I am facing problem whille running the nvt.mdp file. I have...

27 June 2024 9,751 4 View