Are the chances of surviving a plane crash greater over land or water?

More Dennis Atsu Dake's questions See All

How to carry out micro preparation of Zn-2 (Zamak 2) sample surfaces?

I am currently struggling to achieve a good surface finish on mounted Zn-2 samples. Both grinding and polishing (with SiC, silica and diamond) resulted in embedding of the grinding/polishing media...

11 June 2024 2,055 0 View

FFPE mouse femurs appear to have internal bubbles?

I am wondering if this is a technical issue that occured during processing. I have murine femurs that were decalcified in 15% EDTA over 2 weeks and then processed and I embedded them into FFPE....

02 April 2024 6,382 2 View

Is it necessary to include an FMO for 7-AAD dye in your Flow Cytometry experiment? If not, why?

I'm optimizing a flow cytometer experiment and one of my three stains is a 7-AAD Live/Dead stain. The other stains in my experiment are staining for CD34+ and CD45+ cells. Is it necessary to...

01 April 2024 3,060 0 View

What is best way to get lowest adsorption site at subsurface of high entropy alloys?

I am currently studying diffusion of oxygen in high entropy alloys. I want to calculate the activation energy from an adsorption site on the surface to the subsurface. I placed the oxygen atom...

26 March 2024 3,268 0 View

Examples of gender norms that affect men and women's participation in agriculture?

It is a course unit called gender and social economic issues in development ARX 1201

07 January 2024 365 0 View

Is it necessary to to conduct independent simple regressions for a multivariate regression model or this can be derived from the multiple regres?

The objective here is to determine factor sensitivities or slope coefficients in a multiple ols regression model.

17 August 2023 7,825 5 View

Does anyone had problems installing Cytoscape in Ubuntu 22.04.2 LTS?

I am trying to install Cytoscape in Ubuntu 22.04. I followed the instructions on the official website and installed Java 11, 17 and 18. None seems to work. I had this error every time: Error:...

30 May 2023 9,889 2 View

Why is it that when I open a structure and I select atoms in Vesta it crashes immediately?

I am trying to work on a structure in Vesta. But after opening, it crashes when I select atoms to delete. Any help would be deeply appreciated

07 March 2023 5,805 4 View

Working primers for human NPC1 and TrkB qPCR?

For one of our experiments we are planning to run a qPCR on cDNA from human samples. In our first test, we found that our primers for TrkB (forward: ACAGTCAGCTCAAGCCAGACAC, reverse:...

24 January 2023 4,508 3 View

Can standardize test be a data collection tools for descriptive study?

Good day scholars, I am doing a descriptive study and want to administer a standardize test, is it possible?

21 September 2022 6,517 1 View

What is the reason for current dropping in OER , LSV curve?

I tried four trials of the same Copper Phosphides sample in Alkaline medium ( 0.5M KOH) with Hg/HgO reference electrode and Pt as counter electrode. I used 0.001 V/s scan rate for first three...

10 August 2024 3,629 1 View

What may be the reasons for failures of Tube toi Tube Sheet Joints in Boiler Drum ?

We have observed that tube to tube sheet joint leaked in our boiler and needs to overcome same by knowing the root cause.

08 August 2024 3,161 0 View

How much area/acres of agriculture land can irrigate by 1 cusec of water?

Kindly response

08 August 2024 1,214 2 View

What is the problem with these tissue culture plants?

All plants are green but some of these plants becomes yellow. I did not found any reason. Please help me to find out the real problem.

01 August 2024 589 4 View

Where to download DEM from 2018?

I am currently working on validating land subsidence results obtained using SBAS InSAR. Could anyone suggest reliable sources or repositories where I can download a historical DEM from 2018?...

31 July 2024 9,757 3 View

"Idrisi Selva" tutorial Books for pridiction with driving factors in modeling?

Some educational books with practical exercises of the "Idrisi Selva" software, which have step-by-step visual training for predicting the change of land use/land cover and including the use of...

28 July 2024 4,168 0 View

Reason for discontinuities in my Band structure?

Hey All! I am wondering what might be wrong with my band structure. I did the calculations using VASP and plotted the results using Origin. Although I have tried changing various input...

25 July 2024 2,920 11 View

Is it fare for editors of reputed Journals to put on hold manuscripts more than six months without review updates, Are they harassing researchers?

It is being seen that Editors of some reputed Journals are putting on hold the manuscripts and not updating review states even passing more than six months from submission. Researchers are...

24 July 2024 8,596 2 View

How does Chinas CNSA plans for Lunar Base 🚀 integrate with Lunar Artemis, Partner’s, 👨‍🚀 systems 🤖 and timeline?

China will attempt to land on the illuminated rim of Shackleton crater with orbiter, a lander, a mini-hopping probe, and a rover near the lunar south pole with 2026 Chang'e-7 mission with...

19 July 2024 9,815 0 View

Has anyone tried freeze flow samples in -80C freezer or liquid nitrogen before processing?

Our lab has some radioactive cell samples that need to be kept frozen for at least 30 days before flow analysis. For some reason, the samples stored in liquid nitrogen did not perform as well as...

15 July 2024 9,975 1 View