How do I known the annealing temperature of PCR reaction? Primer Sequence is – i> F: ATCTTCCGAAGAATACAAGA and R: CTCAACCCCTATTTAACCTTT . AGAP2 gene , SNPs rs12368653. I work on multiple sclerosis with Vitamin D
Hi, the number of A,T,G,C in your primer determine the annealing temperature of your primer. I use that, just put the primer sequences.
https://www.thermofisher.com/us/en/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/tm-calculator.html
I anwar by adsorption or reaction ..but it is either more method...
02 March 2021 4,811 2 View
Kids globally suffer from dental caries and pose problems for the dentist to treat it with conventional drilling. SDF is recommended to stop progression of carious lesion with out drilling. It...
04 December 2019 4,372 4 View
How can I measure the wavelength of formaldehyde in Aqueous solutions by UV- Vis spectrophotometer, and how much amount of distilled water and formaldehyde can use for this measuring
20 July 2019 983 3 View
I have send them my manuscript for editing and publishing but now I have some doubts about there work
13 May 2019 8,873 4 View
I search for a data center that provides regional groundwater level data for the Nile Basin area especially upper Blue Nile Basin area. I am a bit confused as many published papers do not provide...
26 March 2019 2,841 1 View
I am using graphene sensor to identify biofilm strains. Need to know what are best methods to cleanse the graphene surface to get device ready for next run.
26 May 2018 5,764 3 View
28 March 2017 7,717 3 View
Hello I'm trying to make a simulink model for Venturi tube, for the purpose of measuring volumetric airflow by making a pressure difference with a fan. The paper "Model-based analysis and...
13 December 2016 9,768 6 View
Does difference between GC content of primer and PCR product affect PCR efficiency?
17 June 2016 9,971 5 View
I know of laser light reflecting off or being scattered by particles, but is it possible that particles reflect of a sheet of laser light? For example in the experiments of ultracold atoms in a...
14 January 2016 3,925 5 View
03 March 2021 8,272 1 View
I have a dataset with about 80 different species. As usual, some species are very easy to identify with certainty whereas others are more difficult, which means that I am less certain of my...
03 March 2021 8,066 4 View
I'm dealing with a mediation model and am using the PROCESS module in SPSS. Due to SPSS and PROCESS being limited in the imputation methods - being unable to handle multiple imputation - the other...
02 March 2021 4,362 1 View
Hi, I am planning to apply for the PhD degree in the Supply Chain Mgt. with specific area of "Cold Storage warehouses" during Pandemics and wars. Where lock downs and shut downs are frequent....
02 March 2021 285 2 View
So, I have been trying to run a pACYC PCR which will be used later on for a Gibson Assembly. However the PCR is not working. I have already tried gradient PCR and changing extension time; however...
02 March 2021 1,146 2 View
I have to amplify a gene and my primers just reached. The Tm for Forward primer is 64.2, and that of reverse primer is 65.5. Can some one suggest how to get the best annealing temperature? Thanks...
01 March 2021 360 7 View
I am trying to identify these 3 genes among some tomato cultivar collections and after aligning some sequences from NCBI, I couldn't find unique sequences to target for specific primers. There...
28 February 2021 606 3 View
hello everyone, I need to do standard curves for my qPCR, what is the ideal efficiency range? I tried a primer (Mglu2 receptor) that gave an efficiency of 90.2%. Is it accepted?
28 February 2021 1,254 3 View
Dear All, mirna primer showing some problem in the melting curve? any idea why? As attached is the melting curve. The forward sequence is obtained from miRBase and reverse primer is universal.
28 February 2021 5,008 4 View
Good day researchers I am busy analysing the predicted effects of certain SNP's in AVPR1b. When using the VEP prediction programs (SIFT, Polyphen, FATHMM, LRT, Provean, Mutation Assessor, and...
28 February 2021 5,197 1 View