AGAP2 gene , SNPs rs12368653. PCR product?

23 September 2019 1 899 Report

How do I known the annealing temperature of PCR reaction? Primer Sequence is – i> F: ATCTTCCGAAGAATACAAGA and R: CTCAACCCCTATTTAACCTTT . AGAP2 gene , SNPs rs12368653. I work on multiple sclerosis with Vitamin D

Sikder Nahidul Islam Rabbi

Hi, the number of A,T,G,C in your primer determine the annealing temperature of your primer. I use that, just put the primer sequences.

https://www.thermofisher.com/us/en/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/tm-calculator.html

Badges
Science topic

Similar topics
Social Psychology
Attitude

More Asaad Mohammed Ataa's questions See All

Recovery Viurses from bacteria genome?

Hello everyone, I am currently looking for tools to recovery viral genomes from bacterial genomes, not metagenomes. However, I have only found tools that are designed for retrieving and studying...

28 July 2024 8,953 1 View

Marketing Agility vs. Agile Marketing?

Agile marketing constitutes both a disciplined approach and a mindset, whereas marketing agility represents a quality and feature within a marketer or a department. Do you agree with that? هل...

29 December 2023 7,383 3 View

What is the relationship between organizational immunity and the organization’s life cycle?

ما هي العلاقة بين المناعة التنظيمية و دورة حياة المنظمة؟

19 December 2023 7,799 0 View

What is the relationship between agile human resources management and Job Downsizing?

ما هي العلاقة بين إدارة الموارد البشرية الرشيقة والترشيق الوظيفي؟

17 December 2023 2,491 6 View

What is the difference between Organizational immunity and Organizational recovery?

ما هو الفرق بين المناعة التنظيمة و التعافي التتنظيمي؟

04 December 2023 9,535 1 View

Do I know any Green Neighbourhood Experts in my circle, i really need help with an AHP survey. Please support?

https://www.surveymonkey.com/r/5KQP3D6 For all the experts in green neighbourhoods certification systems, urban planning, or sustainable development I'm currently conducting an expert-based AHP...

14 June 2023 9,740 2 View

How does artificial intelligence influence the auditing industry?

The auditing industry is profoundly affected by artificial intelligence (AI). It is transforming how auditors carry out their responsibilities and enhancing the accuracy and efficacy of the...

11 May 2023 600 2 View

Can a nonhermitian Hamiltonian be a source of chaos?

It is known that imaginary potentials are a source of particles when included into the Gross-Pitaevskii equation. As far as the dynamics of a Bose gas is concerned, is it possible that these...

27 December 2021 347 3 View

Kindly suggest me a strategy management journal indexing in Scopus and Web of Sciences to publish within 3 to 4 months?

Kindly suggest me a strategy management journal indexing in Scopus and Web of Sciences to publish within 3 to 4 months

27 December 2021 5,078 3 View

What are the differences between Medical and Biophysics ?

What are the differences between Medical and Biophysics?

07 March 2021 5,107 9 View

I can't see the ssDNA band after performing asymmetric PCR. Is there any way to do this?

After performing symmetric PCR, PCR purification was performed. Afterwards, asymmetric PCR was performed using the PCR purification product as a template, but no ssDNA band was confirmed in the...

08 August 2024 1,668 3 View

RNA later for the preservation of RNA in fecal samples at room temperature for one day (37°C)?

I am planning to collect human fecal samples for metatranscriptomic analysis using MGI. These samples are from indigenous people living in a region with high temperatures. I will have access to a...

06 August 2024 1,367 3 View

How to understand this crystallographic phenomenon of low temperature crystals in zeolite?

During low-temperature testing, new diffraction peaks that appear could be indicative of several phenomena. In one of our tests, we observed notable new peaks around 40° and 45° in a specific...

06 August 2024 726 3 View

Why after performing site directed mutagenesis ,I don't see any colony after transformation?

I want to introduce a point mutation (change in one nucleotide) into my gene of interest (DNA binding domain) I have designed primers as recommended on the Data sheet of the kit : -Both primers...

05 August 2024 9,059 3 View

Anyone having idea about VN primer for miRNA primer design ?

How to design VN primer to attach with universal reverse primer

05 August 2024 2,116 3 View

Is it possible to improve the reforming section of the Haber-Bosch process without using air separation units?

A typical reforming section in a large-scale Haber-Bosch process (Figure 1) comprises two reactors. A mixture of methane (CH4) and steam (H2O) is fed into a primary reformer to produce syngas via...

01 August 2024 7,051 5 View

I'm optimizing a tetra-ARMS PCR protocol with amplicon sizes: 165bp, 123bp and 93bp. Why, in the gel, only 165bp is visible while I'm expecting all 3?

It's an end-point PCR protocol. I'm using 1.5% agarose gel with SyBR Safe dye and TBE as a running buffer, visualization on BioRad XR+ system. I was primarily thinking of primer efficiency,...

01 August 2024 4,673 4 View

PCR showing no bands - Master mix and primers didn't mix?

Hello everyone, I performed a PCR yesterday, and the results showed no bands on the gel. Of course, I probably missed some crucial steps, like adding my samples to the PCR strips themselves, for...

31 July 2024 2,406 6 View

Why Powder XRD is performed after cruhsing a crystal if Single Crystal XRD analysis of the same crystal has been performed already ?

What information we can get from PXRD analysis other than from SCXRD analysis of a crystal ?

30 July 2024 6,261 4 View

Inquiry on Maximum Nucleic Acid Volume for 2.5 mL Liposome Solution?

I am currently working on a project involving liposomes and need to determine the maximum volume of siRNA that can be added to a 2.5 mL liposome solution with a total lipid concentration of 10...

30 July 2024 6,420 1 View