Has anyone used NLS plasmids that work well for human cell transfections?
Has anyone used the Cherry/ GFP ones, and do they affect protein function once in the nucleus (are non-tagged ones better)?
Does simply attaching the NLS to the end of protein induce nuclear localization in most cases or is it hit or miss as to whether it will enter?
Basic details of why:
My protein does not contain an NLS, but binds another protein that does, which facilitates nuclear entry. I am trying to get my protein into the nucleus to tease apart any effects it may have independent of the other proteins in the complex.
Hi Scott, I did attach successfully an NLS sequence to the 3' end of a GFP-encoding plasmid and it resulted in nuclear localization of the GFP (which is usually cytoplasmic localized). I used the following sequence for the NLS: atggatccgaagaaaaaacgtaaaggccgt
It does not need to work each time since it might change the folding structure of the protein but I would give it a trial. I hope this helps. Good luck!
Hi Nicole,
Perfect thanks!
Yes I've been toiling over whether to go N-(5')/C-(3') term with the addition, the c-term is very unstructured and NLS attached (esp if with GFP) could muck up a few things (other protein interactions etc.
Thanks again for the info!
Best
S
If I would be you I would do both approaches for the cloning and then test a few know interactions for example.
Scott,
What did you end up doing with this? I'm trying to add an NLS to the 3' end of GFP and I'm wondering if I need a linker, multiple NLSs in a row, etc. I can add it to the 5' end also (or instead of), but it'd need to be T2A-NLS-eGFP and I don't know if that needs linkers also. As of right now, there is a GGSGGGSG linker between my T2A and eGFP, and it'd be easiest to just put it on the 3' end.
Mandy
Scott,
I am curious about your findings on this! I am using luciferase reporter constructs and I am not interested in getting protein expression in the nucleus. However, I want to find out if presence or absence of NLS upstream of start site affects protein expression at all?
- Badges
- Science topic