Contact experts in Research Papers to get answers
2,743 views 6,419 posts
Questions related to Research Papers
Necesito una imagen de un árbol filogenético de la flor de la rosa canina
23 February 2024 3,496 0 View
I'm still unexperienced in this field and on ResearchGate. I need to analyze some variants that I found in the 5' upstream region. I would like to know if they occur in a pattern that could be a...
23 February 2024 946 0 View
With accordance to the systematic review and meta-analysis conducted by Zhenzhen Pan et al., about the Diagnostic Efficacy of Serological Antibody Detection Tests for Hepatitis Delta Virus.
22 February 2024 8,765 2 View
How to interpret negative total and direct effects and positive indirect effect? all are significant in mediation analysis X --- M --- Y Total Effect: Negative (-0.42) Indirect Effect 1: Positive...
21 February 2024 507 4 View
With the explosion of a volcano angular pyroclasts occured. During the pyroclastic current, the angular pyroclasts are abraded on their way till settling down. Can you infer the distance of the...
16 February 2024 1,792 0 View
I have emission and sink of CO2 from 2060 to 2015 and I use a box model for the troposphere or world to predict a future scenario in excel and SPSS. I also need to make different scenarios I guess...
16 February 2024 3,161 1 View
I am experimenting with plants and different water treatments. How would I measure the ROS values and what statistical tests could I perform?
16 February 2024 4,119 1 View
I am going to conduct a perspective study on the title of "Gut microbiome in pregnant women with iron deficiency". Objectives to examine the association between gut microbiome and...
16 February 2024 9,987 0 View
I am willing to write and publish my work here on ResearchGate, how do I go about it. Need your guidance.
14 February 2024 1,082 2 View
And are there any ethical concerns associated with this approach?
13 February 2024 7,569 0 View
I am working on a 3T3L1 cell line. I received my cell line with a passage number of 7. Cells were attached until the passage number reached 10. However, after that, cells began detaching from the...
12 February 2024 4,096 0 View
What is the link between sustainability and futures thinking?
12 February 2024 4,345 2 View
I have a book review on a minor book about American political economy. I have published many book reviews before ,mostly on Eats Asian topics. I am not sure where to find a minor journal on...
08 February 2024 8,829 1 View
In relation to the systematic review and meta-analysis of Zhenzhen Pan et al. (2023) about the Diagnostic Efficacy of Serological Antibody Detection Tests for Hepatitis Delta Virus.
07 February 2024 377 4 View
House-selling is one of the typical tasks of the Optimal Stopping problems. Offers come in daily for an asset, such as a house, that you wish to sell. Let Xi denote the amount of the offer...
04 February 2024 4,506 4 View
I am planning to publish a book about my thesis. Can anyone please let me know which publishing house or publisher is good? These days, I am getting more offers from different publishers, and they...
04 February 2024 665 3 View
We cultivate OKT8 hybridoma cells in complete medium with FBS but FBS complicates downstream processing and final product purification. We are going to use HybridomaPlus, Protein-Free Hybridoma...
02 February 2024 9,811 0 View
Dear Colleagues, The sample is serum and, according to our calculations, we have to make a 1:5000 dilution so that the values fall within the standard line. The question we have is how to...
02 February 2024 6,473 3 View
i am a student of Peace and Development Studies and currently working on my thesis and so, i will need research materials from that field. Thank you.
02 February 2024 1,754 2 View
I’m an Italian law student and I’m writing my thesis about the differences between Italy and the US about this topic. Thank you if you help me
02 February 2024 3,741 0 View
The primer sequence is Forward: GGAAGCTTTAGCAAAATCCAGTGTGGTGTA Reverse: AAGGTACCCAAGCTCAATCTAACAATGCAG
01 February 2024 7,095 0 View
Good Day! Thank you for the opportunity, I would like to ask you. Is there any standard method (ASTM or API) for analysis of ammonium bisulfite (as active substance of oxygen scavenger) ? Thank...
30 January 2024 1,949 0 View
Hello everyone, I am trying to develop a thermomechanical user subroutine in Abaqus to do coupled thermomechanical analysis, which includes simultaneous heat transfer and temperature-dependent...
30 January 2024 6,767 4 View
To be developed.
30 January 2024 3,423 1 View